HUGE |
Gene/Protein Characteristic Table for KIAA0890 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01131 |
---|---|
Accession No. : | AB020697 |
Description : | Putative ATP-dependent RNA helicase DHX30. |
HUGO Gene Name : | DEAH (Asp-Glu-Ala-His) box polypeptide 30 (DHX30) |
Clone Name : | hk08057 [Vector Info] |
Flexi ORF Clone : | pF1KA0890
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3800 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 72 bp Genome contig ID gi89161205f_47721817 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GTTTATTTAAAATAAAGTTCTATTTATCCCTTGTGFlanking genome sequence
(144871 - 144920) ----+----*----+----*----+----*----+----*----+----*
ACCACTGCTGTCCACTAGGGGCTCCTCTCTCAGGGCCTCCATACACTGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 47819686 47866686 22 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1210 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AACATCCTGCTGCACAAGTCG | |
: ACGAAGACGCTGCCATTGGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: AACATCCTGCTGCACAAGTCG | |
: ACGAAGACGCTGCCATTGGAC | |
: 104 (0.2k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |