HUGE

Gene/Protein Characteristic Table for KIAA1488

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04770
Accession No. :	AB040921
Description :	Probable ATP-dependent RNA helicase DHX36.
HUGO Gene Name :	DEAH (Asp-Glu-Ala-His) box polypeptide 36 (DHX36)
Clone Name :	fj07893 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3060 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 500 bp

Genome contig ID gi89161205r_155376152
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TCCAGTATTTAATAAAATGTACAATGTTAAATCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCAACCTCTTGGATTGGTTTCTACATTTTCACCTATGGCTTGGTTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 155476152 155515664 23 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 852 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW78761	100.0	DEAH (Asp-Glu-A...	Homo sapiens
Q9H2U1	99.9	Probable ATP-de...	Homo sapiens
XP_001147599	99.8	DEAH (Asp-Glu-A...	Pan troglodytes
XP_001106315	99.1	similar to DEAH...	Macaca mulatta
XP_534311	95.7	similar to DEAH...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020697	8.8e-55	36.3	KIAA0890
AB011149	5.2e-34	32.4	KIAA0577
D86977	3.4e-32	29.9	KIAA0224
D50924	1.3e-30	31.7	KIAA0134
AB040950	1.8e-22	28.1	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 54 218 PF00270 DNA/RNA helicase

IPR001650 357 451 PF00271 DNA/RNA helicase

IPR007502 513 604 PF04408 Helicase-associated region

IPR011709 643 761 PF07717 Domain of unknown function DUF1605

HMMSmart IPR014001 49 240 SM00487 DEAD-like helicases

IPR001650 346 451 SM00490 DNA/RNA helicase

ProfileScan IPR014021 61 231 PS51192 Helicase

IPR001650 321 491 PS51194 DNA/RNA helicase

ScanRegExp IPR002464 173 182 PS00690 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	54	218	PF00270	DNA/RNA helicase
IPR001650	357	451	PF00271	DNA/RNA helicase
IPR007502	513	604	PF04408	Helicase-associated region
IPR011709	643	761	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	49	240	SM00487	DEAD-like helicases
IPR001650	346	451	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	61	231	PS51192	Helicase
IPR001650	321	491	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	173	182	PS00690	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 547 GKMILFGALFCCLDPVLTIAASL 569 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	547	GKMILFGALFCCLDPVLTIAASL	569	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACCTAAAGATGAGAACAAGC

Primer_r
: GCTGGAGACTGAAATACAATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	500 bp
Genome contig ID	gi89161205r_155376152
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TCCAGTATTTAATAAAATGTACAATGTTAAATCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCAACCTCTTGGATTGGTTTCTACATTTTCACCTATGGCTTGGTTCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	155476152	155515664	23	99.8	Perfect prediction

Primer_f	: CACCTAAAGATGAGAACAAGC
Primer_r	: GCTGGAGACTGAAATACAATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1488

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information