HUGE

Gene/Protein Characteristic Table for KIAA0137

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00422
Accession No. :	D50927
Description :	Serine/threonine-protein kinase tousled-like 1.
HUGO Gene Name :	tousled-like kinase 1 (TLK1)
Clone Name :	ha02915s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0137
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha02915, former representative clones for KIAA0137 with ha02915s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4122 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1716 bp

Genome contig ID gi89161199r_171456816
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AAAAATCAGCTGAATAAATTCCTTAAGTATACTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGACAAGTGTAAATTGTTTCAAGCTGTTAAAGTTAAACCTAATAACCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 171556816 171725289 21 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKI8	100.0	Serine/threonin...	Homo sapiens
AAX41019	100.0	tousled-like ki...	synthetic construct
BAF85197	99.9	unnamed protein...	Homo sapiens
XP_535959	99.5	similar to tous...	Canis lupus fam...
XP_001927925	99.5	tousled-like ki...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018265	1.4e-08	30.0	KIAA0722
AB014523	2e-07	31.3	KIAA0623
AB023190	1.2e-05	32.1	KIAA0973
AB002301	1.9e-05	29.3	KIAA0303
AB018350	2e-05	31.8	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 502 767 PD000001 Protein kinase

HMMPfam IPR000719 491 769 PF00069 Protein kinase

HMMSmart IPR001245 491 767 SM00219 Tyrosine protein kinase

IPR002290 491 769 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 491 769 PS50011 Protein kinase

ScanRegExp IPR000719 497 520 PS00107 Protein kinase

IPR008271 617 629 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	502	767	PD000001	Protein kinase
HMMPfam	IPR000719	491	769	PF00069	Protein kinase
HMMSmart	IPR001245	491	767	SM00219	Tyrosine protein kinase
IPR002290	491	769	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	491	769	PS50011	Protein kinase
ScanRegExp	IPR000719	497	520	PS00107	Protein kinase
IPR008271	617	629	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ATCCCCTACACCCCCTTCTTC
Primer_r	: GTCATCCTTCCTTCACTGCTC
PCR product length	: 277 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1716 bp
Genome contig ID	gi89161199r_171456816
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAAATCAGCTGAATAAATTCCTTAAGTATACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGACAAGTGTAAATTGTTTCAAGCTGTTAAAGTTAAACCTAATAACCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	171556816	171725289	21	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0137

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information