HUGE

Gene/Protein Characteristic Table for KIAA0248

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00476
Accession No. :	D87435
Description :	Golgi-specific brefeldin A-resistance guanine nucleotide exchange factor 1.
HUGO Gene Name :	golgi-specific brefeldin A resistance factor 1 (GBF1)
Clone Name :	ha02775s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0248
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha02775, former representative clones for KIAA0248 with ha02775s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6360 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 556 bp

Genome contig ID gi89161187f_103895315
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGGACTTTTTATGATATAATAAATGTCTTAGTACC
Flanking genome sequence
(237326 - 237375)
----+----*----+----*----+----*----+----*----+----*
AGCATCATTGTCTCTCCCTCCGGTTTCCTTCTTGAGCTTGTGGGTCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 103995315 104132639 40 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1880 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_521592	99.5	golgi-specific ...	Pan troglodytes
XP_001104407	99.0	golgi-specific ...	Macaca mulatta
BAG09674	100.0	Golgi-specific ...	synthetic construct
Q92538	99.9	Golgi-specific ...	Homo sapiens
AAI17683	99.7	GBF1 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029033	5.1e-09	33.0	KIAA1110
AB018306	9.4e-09	37.7	KIAA0763
AB011094	1.5e-08	34.6	KIAA0522
AB023159	2.8e-05	26.1	KIAA0942
AB095931	0.00037	30.9	KIAA2011

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000904 717 905 PF01369 SEC7-like

HMMSmart IPR000904 717 905 SM00222 SEC7-like

ProfileScan IPR000904 713 903 PS50190 SEC7-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	717	905	PF01369	SEC7-like
HMMSmart	IPR000904	717	905	SM00222	SEC7-like
ProfileScan	IPR000904	713	903	PS50190	SEC7-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGTTTCCCACTCCCATTAGCC
Primer_r	: CCATGGTGCCAGTCAACTCTC
PCR product length	: 94 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	556 bp
Genome contig ID	gi89161187f_103895315
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGGACTTTTTATGATATAATAAATGTCTTAGTACC
Flanking genome sequence (237326 - 237375)	----+--------+--------+--------+--------+----* AGCATCATTGTCTCTCCCTCCGGTTTCCTTCTTGAGCTTGTGGGTCAGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	103995315	104132639	40	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0248

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information