HUGE |
Gene/Protein Characteristic Table for KIAA0248 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00476 |
---|---|
Accession No. : | D87435 |
Description : | Golgi-specific brefeldin A-resistance guanine nucleotide exchange factor 1. |
HUGO Gene Name : | golgi-specific brefeldin A resistance factor 1 (GBF1) |
Clone Name : | ha02775s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0248
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha02775, former representative clones for KIAA0248 with ha02775s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6360 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 556 bp Genome contig ID gi89161187f_103895315 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGGACTTTTTATGATATAATAAATGTCTTAGTACCFlanking genome sequence
(237326 - 237375) ----+----*----+----*----+----*----+----*----+----*
AGCATCATTGTCTCTCCCTCCGGTTTCCTTCTTGAGCTTGTGGGTCAGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 103995315 104132639 40 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1880 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 10 |
: Genebridge 4 | |
: TGTTTCCCACTCCCATTAGCC | |
: CCATGGTGCCAGTCAACTCTC | |
: 94 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |