HUGE

Gene/Protein Characteristic Table for KIAA1110

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB029033
Description :	IQ motif and Sec7 domain-containing protein 3.
HUGO Gene Name :	IQ motif and Sec7 domain 3 (IQSEC3)
Clone Name :	hh04831b [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5543 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 3312 bp

Genome contig ID gi89161190f_18116
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGAGTTTTAGAGATTATATTGAAAGATGTCACTTG
Flanking genome sequence
(139767 - 139816)
----+----*----+----*----+----*----+----*----+----*
AGCAAACTGTGTCGGCGCAGCTTCTTTTGCTCTCCCAGCGGGGGGGGCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 118116 157881 12 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 740 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW88982	0	99.7	IQ motif and Se...	Homo sapiens
EAW88983	0	99.7	IQ motif and Se...	Homo sapiens
EAW88984	0	99.7	IQ motif and Se...	Homo sapiens
Q9UPP2	0	99.7	IQ motif and SE...	Homo sapiens
NP_056047	3.7e-174	99.3	IQ motif and Se...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011094	1e-42	44.0	KIAA0522
AB018306	1.6e-31	59.0	KIAA0763
D87435	3.7e-08	33.0	KIAA0248
AB095931	0.00023	28.5	KIAA2011
AB023159	0.00031	34.2	KIAA0942

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000904 206 397 PF01369 SEC7-like

HMMSmart IPR000904 206 397 SM00222 SEC7-like

ProfileScan IPR000904 202 395 PS50190 SEC7-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	206	397	PF01369	SEC7-like
HMMSmart	IPR000904	206	397	SM00222	SEC7-like
ProfileScan	IPR000904	202	395	PS50190	SEC7-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGGAGTCTCTTTGTACCCAC

Primer_r
: TTTGGATTAGTTGCTGGGTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	3312 bp
Genome contig ID	gi89161190f_18116
PolyA signal sequence (None)	+--------+--------+----*----+---- AGAGTTTTAGAGATTATATTGAAAGATGTCACTTG
Flanking genome sequence (139767 - 139816)	----+--------+--------+--------+--------+----* AGCAAACTGTGTCGGCGCAGCTTCTTTTGCTCTCCCAGCGGGGGGGGCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	118116	157881	12	99.2	Perfect prediction

Primer_f	: CAGGAGTCTCTTTGTACCCAC
Primer_r	: TTTGGATTAGTTGCTGGGTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1110

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information