HUGE

Gene/Protein Characteristic Table for KIAA0763

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00628
Accession No. :	AB018306
Description :	IQ motif and Sec7 domain-containing protein 1.
HUGO Gene Name :	IQ motif and Sec7 domain 1 (IQSEC1)
Clone Name :	hk04726 [Vector Info]
Flexi ORF Clone :	pF1KSDA0763
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4148 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1516 bp

Genome contig ID gi89161205r_12814374
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
AATGTAAAAATAAAGTTCATCCTAATATGCTGTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATCTTGCTTAAAAATGTCTTCAGCACCCAGTGCAGTGATCTTTCCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 12914374 12958170 13 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 843 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6DN90	100.0	IQ motif and SE...	Homo sapiens
BAG09837	100.0	IQ motif and Se...	synthetic construct
XP_001083503	99.5	similar to IQ m...	Macaca mulatta
XP_516294	99.5	IQ motif and Se...	Pan troglodytes
NP_001127854	100.0	IQ motif and Se...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011094	1.6e-62	62.5	KIAA0522
AB029033	1.3e-48	59.0	KIAA1110
D87435	1.8e-13	37.7	KIAA0248
AB023159	5.8e-08	30.8	KIAA0942
AB095931	1.4e-07	23.6	KIAA2011

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000048 15 35 PF00612 IQ calmodulin-binding region

IPR000904 401 592 PF01369 SEC7-like

HMMSmart IPR000904 401 592 SM00222 SEC7-like

IPR001849 633 744 SM00233 Pleckstrin-like

ProfileScan IPR000048 14 43 PS50096 IQ calmodulin-binding region

IPR000904 397 590 PS50190 SEC7-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	15	35	PF00612	IQ calmodulin-binding region
IPR000904	401	592	PF01369	SEC7-like
HMMSmart	IPR000904	401	592	SM00222	SEC7-like
IPR001849	633	744	SM00233	Pleckstrin-like
ProfileScan	IPR000048	14	43	PS50096	IQ calmodulin-binding region
IPR000904	397	590	PS50190	SEC7-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCATGGGACCGTGTGATTGG

Primer_r
: ACGCCAGATGACATGCAGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCATGGGACCGTGTGATTGG
Primer_r	: ACGCCAGATGACATGCAGCAG
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1516 bp
Genome contig ID	gi89161205r_12814374
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AATGTAAAAATAAAGTTCATCCTAATATGCTGTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATCTTGCTTAAAAATGTCTTCAGCACCCAGTGCAGTGATCTTTCCCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	12914374	12958170	13	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0763

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information