HUGE |
Gene/Protein Characteristic Table for KIAA0522 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05530 |
---|---|
Accession No. : | AB011094 |
Description : | IQ motif and Sec7 domain-containing protein 2. |
HUGO Gene Name : | IQ motif and Sec7 domain 2 (IQSEC2) |
Clone Name : | hg01393 [Vector Info] |
Flexi ORF Clone : | pF1KA0522
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6022 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1354 bp Genome contig ID gi89161218r_53178784 PolyA signal sequence
(CATAAA,-31) +----*----+----*----+----*----+----
GCCTCATAAAAGACCTTGTGCTCAAAAAAAAAAACFlanking genome sequence
(288464 - 288415) ----+----*----+----*----+----*----+----*----+----*
CTAAGGCCCCTGCCTTATTAATGATAGAGAGCAGAGAGGGAAGAGAGGTA
Features of the protein sequence |
Description | |
---|---|---|
Length: 1555 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GAGCACAAGGTCTTTTATGAG | |
: ATGGACCCTGGCTGTACGAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: X |
: GeneBridge 4 | |
: GAGCACAAGGTCTTTTATGAG | |
: ATGGACCCTGGCTGTACGAAG | |
: 164 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |