HUGE |
Gene/Protein Characteristic Table for KIAA0357 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04800 |
---|---|
Accession No. : | AB002355 |
Description : | Ciliary dynein heavy chain 9. |
HUGO Gene Name : | dynein, axonemal, heavy chain 9 (DNAH9) |
Clone Name : | hh00016y2 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh00016, former representative clones for KIAA0357 with hh00016y2. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9198 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 219 bp Genome contig ID gi51511734f_11434119 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GGGCCCAGGTTTCTTAATAAAATGATTTACTCTTCFlanking genome sequence
(379671 - 379720) ----+----*----+----*----+----*----+----*----+----*
AACTGTGTCTGGCCCAGGATTTGAGAGCTGCTGAATCATAAATGATCATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 11534119 11813788 49 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2992 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CCACATTCCTTCAGCTCAGCC | |
: CACCACAGACACTTAGAACGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: CCACATTCCTTCAGCTCAGCC | |
: CACCACAGACACTTAGAACGG | |
: 112 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |