HUGE

Gene/Protein Characteristic Table for KIAA1697

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04799
Accession No. :	AB051484
Description :
HUGO Gene Name :
Clone Name :	fj14406y2 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj14406, former representative clones for KIAA1697 with fj14406y2. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6721 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 172 bp

Genome contig ID gi89161199f_84639660
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTTATGACCTTAAAATAAAGTGTTTGAGTTCTTTC
Flanking genome sequence
(260557 - 260606)
----+----*----+----*----+----*----+----*----+----*
TGTTGGCAATCCAAGCTCTGCTGTAGAAGCAGTGGGTTCAACAACCCACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 84739654 84900215 41 99.9 Terminal No-hit

Features of the protein sequence	Description

Length: 2182 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06719	100.0	DNAH6 variant p...	Homo sapiens
Q9C0G6	100.0	Dynein heavy ch...	Homo sapiens
XP_515578	98.8	similar to SI:z...	Pan troglodytes
XP_001082827	98.2	similar to Dyne...	Macaca mulatta
XP_001916921	93.6	similar to Dyne...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	1.2e-191	40.2	KIAA1503
AB095937	3e-164	34.4	KIAA2017
AB002355	4.7e-152	32.4	KIAA0357
AB023161	8.4e-88	41.7	KIAA0944
AB037831	7e-86	41.5	KIAA1410

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011704 115 262 PF07728 ATPase associated with various cellular activities

IPR004273 1512 2179 PF03028 Dynein heavy chain

HMMSmart IPR003593 112 265 SM00382 AAA+ ATPase

IPR003593 463 621 SM00382 AAA+ ATPase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011704	115	262	PF07728	ATPase associated with various cellular activities
IPR004273	1512	2179	PF03028	Dynein heavy chain
HMMSmart	IPR003593	112	265	SM00382	AAA+ ATPase
IPR003593	463	621	SM00382	AAA+ ATPase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATTTTGCACCCATGGCTGAC

Primer_r
: GTAGATGACCTTGGCTGAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: CCR
Primer_f	: TATTTTGCACCCATGGCTGAC
Primer_r	: GTAGATGACCTTGGCTGAACC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	172 bp
Genome contig ID	gi89161199f_84639660
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTATGACCTTAAAATAAAGTGTTTGAGTTCTTTC
Flanking genome sequence (260557 - 260606)	----+--------+--------+--------+--------+----* TGTTGGCAATCCAAGCTCTGCTGTAGAAGCAGTGGGTTCAACAACCCACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	84739654	84900215	41	99.9	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1697

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information