HUGE |
Gene/Protein Characteristic Table for KIAA1410 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00827 |
---|---|
Accession No. : | AB037831 |
Description : | dynein, axonemal, heavy chain 1. |
HUGO Gene Name : | |
Clone Name : | pg00933y4 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1410
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced fh06675 and pg00933y2, former representative clones for KIAA1410 with pg00933y4. (2003/4/2,2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 13104 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 45 bp Genome contig ID gi89161205f_52225375 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
AAGGGCTGGGGCCATTAAAGCTGAATTTTCTAAGCFlanking genome sequence
(184174 - 184223) ----+----*----+----*----+----*----+----*----+----*
AGTCCAGCTGTGCCTTAGCTGCTTGCATGAGGACCCCTCTGCAGGACTCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 52325375 52409547 78 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 4293 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: ATCGAGGTGCTGTCTGTGGTG | |
: AGATTGTCAGGCAGCTCCGTG | |
: 173(800) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |