HUGE

Gene/Protein Characteristic Table for KIAA1503

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02065
Accession No. :	AB040936
Description :	dynein heavy chain domain 3.
HUGO Gene Name :	dynein, axonemal, heavy chain 2 (DNAH2)
Clone Name :	hk03643y1 [Vector Info]
Flexi ORF Clone :	pF1KA1503
Source :	Human adult brain
Note :	We replaced hk03643, former representative clones for KIAA1503 with hk03643y1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 14955 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 211 bp

Genome contig ID gi51511734f_7461397
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAGCTCAGTGCTGTAAAACACCCGCGACAACAAGC
Flanking genome sequence
(216392 - 216441)
----+----*----+----*----+----*----+----*----+----*
CTTAAGTCTCTCAATGCAATGGTGAGGGTCTGGGGAGGGAGGAAGCCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 7561397 7677787 86 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 4464 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72530	100.0	dynein, axonema...	synthetic construct
Q9P225	99.9	Dynein heavy ch...	Homo sapiens
XP_001255916	92.3	similar to dyne...	Bos taurus
XP_001918411	92.3	dynein, axonema...	Equus caballus
XP_001079413	91.0	similar to dyne...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002355	0	37.2	KIAA0357
AB095937	0	39.6	KIAA2017
AB051484	1.4e-165	40.2	KIAA1697
AB046823	3.4e-127	37.2	KIAA1603
AB082528	4.1e-99	27.6	KIAA1997

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013594 275 764 PF08385 Dynein heavy chain

IPR013602 1255 1670 PF08393 Dynein heavy chain

IPR011704 2116 2267 PF07728 ATPase associated with various cellular activities

IPR011704 2448 2594 PF07728 ATPase associated with various cellular activities

IPR004273 3755 4461 PF03028 Dynein heavy chain

HMMSmart IPR003593 1834 1970 SM00382 AAA+ ATPase

IPR003593 2445 2592 SM00382 AAA+ ATPase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	275	764	PF08385	Dynein heavy chain
IPR013602	1255	1670	PF08393	Dynein heavy chain
IPR011704	2116	2267	PF07728	ATPase associated with various cellular activities
IPR011704	2448	2594	PF07728	ATPase associated with various cellular activities
IPR004273	3755	4461	PF03028	Dynein heavy chain
HMMSmart	IPR003593	1834	1970	SM00382	AAA+ ATPase
IPR003593	2445	2592	SM00382	AAA+ ATPase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCCCTGCCTTTTCAATGTCC

Primer_r
: TGAAGGCTCCGGGACTAAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCCCTGCCTTTTCAATGTCC
Primer_r	: TGAAGGCTCCGGGACTAAAGG
PCR product length	: 140 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	211 bp
Genome contig ID	gi51511734f_7461397
PolyA signal sequence (None)	+--------+--------+----*----+---- GAGCTCAGTGCTGTAAAACACCCGCGACAACAAGC
Flanking genome sequence (216392 - 216441)	----+--------+--------+--------+--------+----* CTTAAGTCTCTCAATGCAATGGTGAGGGTCTGGGGAGGGAGGAAGCCCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	7561397	7677787	86	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1503

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information