HUGE |
Gene/Protein Characteristic Table for KIAA1997 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK04848 |
---|---|
Accession No. : | AB082528 |
Description : | dynein, cytoplasmic 2, heavy chain 1. |
HUGO Gene Name : | |
Clone Name : | bj00195y1 [Vector Info] |
Flexi ORF Clone : | pF1KA1997
![]() |
Source : | Human adult brain |
Note : | We replaced bj00195, former representative clones for KIAA1997 with bj00195y1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5429 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 370 bp Genome contig ID gi51511727f_102475193 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGTCATAATTATTTAATAAAAGAGCATTCATAATTFlanking genome sequence
(380370 - 380419) ----+----*----+----*----+----*----+----*----+----*
TTTGCAGTCTTCCCATGACTCTTTTTACATACTGAAGAATGTATTATAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 102575193 102855561 41 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1685 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 11 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |