HUGE |
Gene/Protein Characteristic Table for KIAA2017 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05745 |
---|---|
Accession No. : | AB095937 |
Description : | dynein, axonemal, heavy chain 10 isoform 1. |
HUGO Gene Name : | |
Clone Name : | fk13965y1 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fk13965, former representative clones for KIAA2017 with fk13965y1. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9388 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 232 bp Genome contig ID gi89161190f_122783683 PolyA signal sequence
(AGTAAA,-17) +----*----+----*----+----*----+----
GAATTTATATAATCAAAAAGTAAATATTGGAGAGTFlanking genome sequence
(202532 - 202581) ----+----*----+----*----+----*----+----*----+----*
ATTTTAAGATGTGTGGAGTTTTCTTTTCCTTCTCAGAGAAAACACTTGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 122883683 122986213 53 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 3051 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CATCCTGTTCTTCGTCCTGTC | |
: AGCGTGTCCATGATGTTCCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |