HUGE |
Gene/Protein Characteristic Table for KIAA0944 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK02006 |
---|---|
Accession No. : | AB023161 |
Description : | dynein, axonemal, heavy chain 7. |
HUGO Gene Name : | dynein, axonemal, heavy chain 7 (DNAH7) |
Clone Name : | hj04408s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0944 |
Source : | Human adult brain |
Note : | We replaced hj04408, former representative clones for KIAA0944 with hj04408s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 12418 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 4031 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTGACCAACCCAAGGAACAC | |
: TCTACTCAGCCAGCCAACAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: TCTGACCAACCCAAGGAACAC | |
: TCTACTCAGCCAGCCAACAAG | |
: 117 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |