HUGE

Gene/Protein Characteristic Table for KIAA0325

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04846
Accession No. :	AB002323
Description :	Dynein heavy chain, cytosolic.
HUGO Gene Name :
Clone Name :	hg00575y2 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00575 and hg00575y1, former representative clones for KIAA0325 with hg00575y2. (2003/4/2,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 14205 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 228 bp

Genome contig ID gi51511730f_101400746
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CGTGGCTCCTTTGAGGAAATAAAACACTAAGCATG
Flanking genome sequence
(186137 - 186186)
----+----*----+----*----+----*----+----*----+----*
AGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGGGCACAGAGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 101500746 101586881 78 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 4658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14204	100.0	Cytoplasmic dyn...	Homo sapiens
XP_537556	99.2	similar to dyne...	Canis lupus fam...
XP_001491244	99.3	similar to dyne...	Equus caballus
NP_084514	99.2	cytoplasmic dyn...	Mus musculus
Q9JHU4	99.1	Cytoplasmic dyn...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082528	4.1e-75	28.3	KIAA1997
AB046823	5.5e-62	26.0	KIAA1603
AB040936	4.1e-44	26.2	KIAA1503
AB051484	8.5e-32	27.0	KIAA1697
AB095937	2.4e-25	29.7	KIAA2017

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013594 250 846 PF08385 Dynein heavy chain

IPR013602 1329 1737 PF08393 Dynein heavy chain

IPR011704 2231 2379 PF07728 ATPase associated with various cellular activities

IPR011704 2602 2751 PF07728 ATPase associated with various cellular activities

IPR004273 3927 4657 PF03028 Dynein heavy chain

HMMSmart IPR003593 1913 2057 SM00382 AAA+ ATPase

IPR003593 2228 2379 SM00382 AAA+ ATPase

IPR003593 2599 2749 SM00382 AAA+ ATPase

IPR003593 2941 3107 SM00382 AAA+ ATPase

ScanRegExp IPR000169 2228 2238 PS00639 Peptidase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	250	846	PF08385	Dynein heavy chain
IPR013602	1329	1737	PF08393	Dynein heavy chain
IPR011704	2231	2379	PF07728	ATPase associated with various cellular activities
IPR011704	2602	2751	PF07728	ATPase associated with various cellular activities
IPR004273	3927	4657	PF03028	Dynein heavy chain
HMMSmart	IPR003593	1913	2057	SM00382	AAA+ ATPase
IPR003593	2228	2379	SM00382	AAA+ ATPase
IPR003593	2599	2749	SM00382	AAA+ ATPase
IPR003593	2941	3107	SM00382	AAA+ ATPase
ScanRegExp	IPR000169	2228	2238	PS00639	Peptidase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGCCTTCCCAAATACCTCCTG

Primer_r
: GTGAAAAGAAAGTGGTTGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCCTTCCCAAATACCTCCTG
Primer_r	: GTGAAAAGAAAGTGGTTGGTC
PCR product length	: 103 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	228 bp
Genome contig ID	gi51511730f_101400746
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CGTGGCTCCTTTGAGGAAATAAAACACTAAGCATG
Flanking genome sequence (186137 - 186186)	----+--------+--------+--------+--------+----* AGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGGGCACAGAGCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	101500746	101586881	78	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0325

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information