HUGE |
Gene/Protein Characteristic Table for KIAA0325 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04846 |
---|---|
Accession No. : | AB002323 |
Description : | Dynein heavy chain, cytosolic. |
HUGO Gene Name : | |
Clone Name : | hg00575y2 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hg00575 and hg00575y1, former representative clones for KIAA0325 with hg00575y2. (2003/4/2,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 14205 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 228 bp Genome contig ID gi51511730f_101400746 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGFlanking genome sequence
(186137 - 186186) ----+----*----+----*----+----*----+----*----+----*
AGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGGGCACAGAGCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 101500746 101586881 78 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 4658 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GGCCTTCCCAAATACCTCCTG | |
: GTGAAAAGAAAGTGGTTGGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: GGCCTTCCCAAATACCTCCTG | |
: GTGAAAAGAAAGTGGTTGGTC | |
: 103 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |