HUGE |
Gene/Protein Characteristic Table for KIAA0686 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05615 |
---|---|
Accession No. : | AB014586 |
Description : | G-protein coupled receptor 98 precursor. |
HUGO Gene Name : | G protein-coupled receptor 98 (GPR98) |
Clone Name : | fj02322 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced hk02975, former representative clones for KIAA0686 with fj02322. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3918 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 315 bp Genome contig ID gi51511721f_90042152 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TAATGAAAGTAATAATCAATAAAGCAATAGAATCTFlanking genome sequence
(453638 - 453687) ----+----*----+----*----+----*----+----*----+----*
ATTTGGTATCATCCAGCTTCATTATTGATAAAGAAACATTGTGCATGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 90142152 90495788 17 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1200 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTGCCTCCATTTCTTCTGCTC | |
: AGGCAAAGTAAAGGCTCACAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: GTGCCTCCATTTCTTCTGCTC | |
: AGGCAAAGTAAAGGCTCACAG | |
: 164 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |