HUGE

Gene/Protein Characteristic Table for KIAA1015

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB023232
Description :	Zinc finger protein with KRAB and SCAN domains 5.
HUGO Gene Name :
Clone Name :	hk03609 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4148 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1572 bp

Genome contig ID gi89161213f_98840568
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CAAAGGCGTTTCCCAAATAAATCACACTGTCAATC
Flanking genome sequence
(128814 - 128863)
----+----*----+----*----+----*----+----*----+----*
ACATGGTTCTGAATCCCTGTCTCAGGCTCTGCTTTAGAGAACCTGATCTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 98940568 98969380 7 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 841 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2L8	100.0	Zinc finger pro...	Homo sapiens
AAH30790	99.9	ZKSCAN5 protein...	Homo sapiens
BAG51370	99.8	unnamed protein...	Homo sapiens
A2T7D2	99.6	Zinc finger pro...	Pan troglodytes
XP_001505067	90.8	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037770	3.3e-54	39.9	KIAA1349
AB075862	4.9e-53	39.0	KIAA1982
AB018341	1.9e-48	34.2	KIAA0798
AB037817	3.3e-48	35.3	KIAA1396
AB058755	5.5e-45	36.3	KIAA1852

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 348 371 PD000003 Zinc finger

IPR007087 376 399 PD000003 Zinc finger

IPR007087 432 454 PD000003 Zinc finger

IPR007087 551 574 PD000003 Zinc finger

IPR007087 579 602 PD000003 Zinc finger

IPR007087 607 630 PD000003 Zinc finger

IPR007087 635 658 PD000003 Zinc finger

IPR007087 719 742 PD000003 Zinc finger

IPR007087 775 798 PD000003 Zinc finger

HMMPfam IPR003309 46 141 PF02023 Transcriptional regulator SCAN

IPR001909 223 260 PF01352 KRAB box

IPR007087 348 370 PF00096 Zinc finger

IPR007087 376 398 PF00096 Zinc finger

IPR007087 404 426 PF00096 Zinc finger

IPR007087 432 454 PF00096 Zinc finger

IPR007087 551 573 PF00096 Zinc finger

IPR007087 579 601 PF00096 Zinc finger

IPR007087 607 629 PF00096 Zinc finger

IPR007087 635 657 PF00096 Zinc finger

IPR007087 663 685 PF00096 Zinc finger

IPR007087 719 741 PF00096 Zinc finger

IPR007087 775 797 PF00096 Zinc finger

IPR007087 803 825 PF00096 Zinc finger

HMMSmart IPR003309 48 157 SM00431 Transcriptional regulator SCAN

IPR001909 220 283 SM00349 KRAB box

IPR015880 348 370 SM00355 Zinc finger

IPR015880 376 398 SM00355 Zinc finger

IPR015880 404 426 SM00355 Zinc finger

IPR015880 432 454 SM00355 Zinc finger

IPR015880 551 573 SM00355 Zinc finger

IPR015880 579 601 SM00355 Zinc finger

IPR015880 607 629 SM00355 Zinc finger

IPR015880 635 657 SM00355 Zinc finger

IPR015880 663 685 SM00355 Zinc finger

IPR015880 719 741 SM00355 Zinc finger

IPR015880 775 797 SM00355 Zinc finger

IPR015880 803 825 SM00355 Zinc finger

ProfileScan IPR003309 53 134 PS50804 Transcriptional regulator SCAN

IPR001909 220 293 PS50805 KRAB box

IPR007087 348 375 PS50157 Zinc finger

IPR007087 376 403 PS50157 Zinc finger

IPR007087 404 431 PS50157 Zinc finger

IPR007087 432 459 PS50157 Zinc finger

IPR007087 551 578 PS50157 Zinc finger

IPR007087 579 606 PS50157 Zinc finger

IPR007087 607 634 PS50157 Zinc finger

IPR007087 635 662 PS50157 Zinc finger

IPR007087 663 690 PS50157 Zinc finger

IPR007087 719 746 PS50157 Zinc finger

IPR007087 747 774 PS50157 Zinc finger

IPR007087 775 802 PS50157 Zinc finger

IPR007087 803 830 PS50157 Zinc finger

ScanRegExp IPR007087 350 370 PS00028 Zinc finger

IPR007087 378 398 PS00028 Zinc finger

IPR007087 406 426 PS00028 Zinc finger

IPR007087 434 454 PS00028 Zinc finger

IPR007087 553 573 PS00028 Zinc finger

IPR007087 581 601 PS00028 Zinc finger

IPR007087 609 629 PS00028 Zinc finger

IPR007087 637 657 PS00028 Zinc finger

IPR007087 665 685 PS00028 Zinc finger

IPR007087 721 741 PS00028 Zinc finger

IPR007087 777 797 PS00028 Zinc finger

IPR007087 805 825 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	348	371	PD000003	Zinc finger
IPR007087	376	399	PD000003	Zinc finger
IPR007087	432	454	PD000003	Zinc finger
IPR007087	551	574	PD000003	Zinc finger
IPR007087	579	602	PD000003	Zinc finger
IPR007087	607	630	PD000003	Zinc finger
IPR007087	635	658	PD000003	Zinc finger
IPR007087	719	742	PD000003	Zinc finger
IPR007087	775	798	PD000003	Zinc finger
HMMPfam	IPR003309	46	141	PF02023	Transcriptional regulator SCAN
IPR001909	223	260	PF01352	KRAB box
IPR007087	348	370	PF00096	Zinc finger
IPR007087	376	398	PF00096	Zinc finger
IPR007087	404	426	PF00096	Zinc finger
IPR007087	432	454	PF00096	Zinc finger
IPR007087	551	573	PF00096	Zinc finger
IPR007087	579	601	PF00096	Zinc finger
IPR007087	607	629	PF00096	Zinc finger
IPR007087	635	657	PF00096	Zinc finger
IPR007087	663	685	PF00096	Zinc finger
IPR007087	719	741	PF00096	Zinc finger
IPR007087	775	797	PF00096	Zinc finger
IPR007087	803	825	PF00096	Zinc finger
HMMSmart	IPR003309	48	157	SM00431	Transcriptional regulator SCAN
IPR001909	220	283	SM00349	KRAB box
IPR015880	348	370	SM00355	Zinc finger
IPR015880	376	398	SM00355	Zinc finger
IPR015880	404	426	SM00355	Zinc finger
IPR015880	432	454	SM00355	Zinc finger
IPR015880	551	573	SM00355	Zinc finger
IPR015880	579	601	SM00355	Zinc finger
IPR015880	607	629	SM00355	Zinc finger
IPR015880	635	657	SM00355	Zinc finger
IPR015880	663	685	SM00355	Zinc finger
IPR015880	719	741	SM00355	Zinc finger
IPR015880	775	797	SM00355	Zinc finger
IPR015880	803	825	SM00355	Zinc finger
ProfileScan	IPR003309	53	134	PS50804	Transcriptional regulator SCAN
IPR001909	220	293	PS50805	KRAB box
IPR007087	348	375	PS50157	Zinc finger
IPR007087	376	403	PS50157	Zinc finger
IPR007087	404	431	PS50157	Zinc finger
IPR007087	432	459	PS50157	Zinc finger
IPR007087	551	578	PS50157	Zinc finger
IPR007087	579	606	PS50157	Zinc finger
IPR007087	607	634	PS50157	Zinc finger
IPR007087	635	662	PS50157	Zinc finger
IPR007087	663	690	PS50157	Zinc finger
IPR007087	719	746	PS50157	Zinc finger
IPR007087	747	774	PS50157	Zinc finger
IPR007087	775	802	PS50157	Zinc finger
IPR007087	803	830	PS50157	Zinc finger
ScanRegExp	IPR007087	350	370	PS00028	Zinc finger
IPR007087	378	398	PS00028	Zinc finger
IPR007087	406	426	PS00028	Zinc finger
IPR007087	434	454	PS00028	Zinc finger
IPR007087	553	573	PS00028	Zinc finger
IPR007087	581	601	PS00028	Zinc finger
IPR007087	609	629	PS00028	Zinc finger
IPR007087	637	657	PS00028	Zinc finger
IPR007087	665	685	PS00028	Zinc finger
IPR007087	721	741	PS00028	Zinc finger
IPR007087	777	797	PS00028	Zinc finger
IPR007087	805	825	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGGTGCTATGACTGCTCTGG

Primer_r
: TTGAGGGAGGGAATGAAACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGGTGCTATGACTGCTCTGG
Primer_r	: TTGAGGGAGGGAATGAAACAG
PCR product length	: 113 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	1572 bp
Genome contig ID	gi89161213f_98840568
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAAAGGCGTTTCCCAAATAAATCACACTGTCAATC
Flanking genome sequence (128814 - 128863)	----+--------+--------+--------+--------+----* ACATGGTTCTGAATCCCTGTCTCAGGCTCTGCTTTAGAGAACCTGATCTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	98940568	98969380	7	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1015

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information