HUGE

Gene/Protein Characteristic Table for KIAA1057

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07312
Accession No. :	AB028980
Description :	Ubiquitin carboxyl-terminal hydrolase 24.
HUGO Gene Name :	ubiquitin specific peptidase 24 (USP24)
Clone Name :	hh11838 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5618 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2683 bp

Genome contig ID gi89161185r_55204623
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AGCTTCTAAGAGTATAAAATAAATTTTTCAAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAGTTGGAGTCTTGCCGCCATTCTTCATATATCAGAACACAGCCGTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 55304623 55342233 27 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 977 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06658	100.0	hCG33036, isofo...	Homo sapiens
AAI60138	99.9	Ubiquitin speci...	synthetic construct
Q9UPU5	99.9	Ubiquitin carbo...	Homo sapiens
XP_513431	99.8	ubiquitin speci...	Pan troglodytes
XP_001108457	99.5	ubiquitin speci...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011142	9e-28	26.0	KIAA0570
AB040886	4.2e-08	27.8	KIAA1453
D29956	7e-08	24.9	KIAA0055
AB067478	1.9e-05	26.5	KIAA1891
AB023220	0.00029	29.2	KIAA1003

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 43 396 PF00443 Peptidase C19

ProfileScan IPR001394 46 400 PS50235 Peptidase C19

ScanRegExp IPR001394 47 62 PS00972 Peptidase C19

IPR001394 311 328 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	43	396	PF00443	Peptidase C19
ProfileScan	IPR001394	46	400	PS50235	Peptidase C19
ScanRegExp	IPR001394	47	62	PS00972	Peptidase C19
IPR001394	311	328	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGATTTGCCAAGTCACAGAG

Primer_r
: AACAATGAAGTCTGACAGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2683 bp
Genome contig ID	gi89161185r_55204623
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGCTTCTAAGAGTATAAAATAAATTTTTCAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGTTGGAGTCTTGCCGCCATTCTTCATATATCAGAACACAGCCGTAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	55304623	55342233	27	99.5	Perfect prediction

Primer_f	: CAGATTTGCCAAGTCACAGAG
Primer_r	: AACAATGAAGTCTGACAGCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1057

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information