HUGE

Gene/Protein Characteristic Table for KIAA1090

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07365
Accession No. :	AB029013
Description :	Probable histone-lysine N-methyltransferase NSD2.
HUGO Gene Name :
Clone Name :	hk03921a [Vector Info]
Flexi ORF Clone :	pF1KA1090
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2670 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 6 bp

Genome contig ID gi89161207f_1823630
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCTGGCGGAGAGTCACAGAGGGCAAATAGCGCCAG
Flanking genome sequence
(126812 - 126861)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCTTGGCCGGATCCAGGGGCGGTGCAGGGCGGCCGGCCCTGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 1923627 1950440 12 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52413	100.0	WHSC1 protein [...	Homo sapiens
CAM15220	99.9	Wolf-Hirschhorn...	Homo sapiens
XP_001145170	99.9	Wolf-Hirschhorn...	Pan troglodytes
EAW82551	97.5	Wolf-Hirschhorn...	Homo sapiens
O96028	97.5	Probable histon...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051519	1.2e-29	40.3	KIAA1732
AB002386	3.1e-12	32.5	KIAA0388
AB028999	4.2e-10	34.8	KIAA1076
AB002337	2.4e-08	35.2	KIAA0339
AB002302	3.7e-08	35.8	KIAA0304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 183 225 PF00628 Zinc finger

IPR000313 227 301 PF00855 PWWP

IPR001214 407 536 PF00856 SET

IPR001965 591 638 PF00628 Zinc finger

HMMSmart IPR001965 66 113 SM00249 Zinc finger

IPR001965 183 223 SM00249 Zinc finger

IPR000313 228 290 SM00293 PWWP

IPR006560 361 412 SM00570 AWS

IPR001214 413 536 SM00317 SET

IPR003616 537 553 SM00508 Post-SET zinc-binding region

IPR001965 591 634 SM00249 Zinc finger

ProfileScan IPR001841 67 113 PS50089 Zinc finger

IPR001965 181 225 PS50016 Zinc finger

IPR000313 230 292 PS50812 PWWP

IPR006560 361 411 PS51215 AWS

IPR001214 412 534 PS50280 SET

IPR003616 537 553 PS50868 Post-SET zinc-binding region

ScanRegExp IPR001965 184 222 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	183	225	PF00628	Zinc finger
IPR000313	227	301	PF00855	PWWP
IPR001214	407	536	PF00856	SET
IPR001965	591	638	PF00628	Zinc finger
HMMSmart	IPR001965	66	113	SM00249	Zinc finger
IPR001965	183	223	SM00249	Zinc finger
IPR000313	228	290	SM00293	PWWP
IPR006560	361	412	SM00570	AWS
IPR001214	413	536	SM00317	SET
IPR003616	537	553	SM00508	Post-SET zinc-binding region
IPR001965	591	634	SM00249	Zinc finger
ProfileScan	IPR001841	67	113	PS50089	Zinc finger
IPR001965	181	225	PS50016	Zinc finger
IPR000313	230	292	PS50812	PWWP
IPR006560	361	411	PS51215	AWS
IPR001214	412	534	PS50280	SET
IPR003616	537	553	PS50868	Post-SET zinc-binding region
ScanRegExp	IPR001965	184	222	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCAATTCGTTCTGTAAGGAG

Primer_r
: GCTATTTGCCCTCTGTGACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCAATTCGTTCTGTAAGGAG
Primer_r	: GCTATTTGCCCTCTGTGACTC
PCR product length	: 202 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	6 bp
Genome contig ID	gi89161207f_1823630
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTGGCGGAGAGTCACAGAGGGCAAATAGCGCCAG
Flanking genome sequence (126812 - 126861)	----+--------+--------+--------+--------+----* GCGGCCGCTTGGCCGGATCCAGGGGCGGTGCAGGGCGGCCGGCCCTGCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	1923627	1950440	12	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1090

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information