HUGE |
Gene/Protein Characteristic Table for KIAA1732 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06787 |
---|---|
Accession No. : | AB051519 |
Description : | Histone-lysine N-methyltransferase SETD2. |
HUGO Gene Name : | SET domain containing 2 (SETD2) |
Clone Name : | bg00050 [Vector Info] |
Flexi ORF Clone : | pF1KA1732 |
Source : | Human adult brain |
Note : | We replaced ph00196, former representative clones for KIAA1732 with bg00050. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6403 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 655 bp Genome contig ID gi89161205r_46932932 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
GAACTTTTTATGTAAAAAAATAAAATCAATTAAAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTTGGCATGTGTGTTCCCTAAAAGTTAATCAAGCATATTTGTGTGTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 47032932 47139182 19 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1915 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TAGTTGTGAGCTGTTGGCATG | |
: ACAGATCATCAGGGTAAAGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: |
: | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |