HUGE

Gene/Protein Characteristic Table for KIAA1366

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06161
Accession No. :	AB037787
Description :	Neuroligin-2 precursor.
HUGO Gene Name :	neuroligin 2 (NLGN2)
Clone Name :	fj02695 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3716 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2061 bp

Genome contig ID gi51511734f_7159008
PolyA signal sequence
(TATAAA,-18)
+----*----+----*----+----*----+----
GAAGAGAATATTGTAAATATAAAAGTTTAACTGTT
Flanking genome sequence
(104897 - 104946)
----+----*----+----*----+----*----+----*----+----*
GGTTGTGCCTGCTCTGTTGTGGGGAGGGCGGTCTCTAAAGAAACAAGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 7259008 7263903 3 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_523830	1.2e-179	100.0	neuroligin 2 [P...	Pan troglodytes
XP_001108431	1.3e-179	100.0	similar to neur...	Macaca mulatta
Q8NFZ4	1.3e-179	100.0	Neuroligin-2; F...	Homo sapiens
XP_001254643	2.5e-179	99.8	neuroligin 2 [B...	Bos taurus
XP_001503121	1.4e-177	98.9	neuroligin 2, p...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028993	1e-52	63.0	KIAA1070
AB033086	3.6e-51	62.5	KIAA1260
AB023168	7.5e-51	62.0	KIAA0951
AB040913	2.5e-50	62.5	KIAA1480

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000460 162 176 PR01090 Neuroligin

IPR000460 265 286 PR01090 Neuroligin

IPR000460 295 313 PR01090 Neuroligin

IPR000460 385 414 PR01090 Neuroligin

HMMPfam IPR002018 1 316 PF00135 Carboxylesterase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000460	162	176	PR01090	Neuroligin
IPR000460	265	286	PR01090	Neuroligin
IPR000460	295	313	PR01090	Neuroligin
IPR000460	385	414	PR01090	Neuroligin
HMMPfam	IPR002018	1	316	PF00135	Carboxylesterase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 391 LSVTVAVGASLLFLNILAFAAL 412 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	391	LSVTVAVGASLLFLNILAFAAL	412	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTTCCACTGACACCCAAATC

Primer_r
: CCAATTCTGAGGGCATCTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2061 bp
Genome contig ID	gi51511734f_7159008
PolyA signal sequence (TATAAA,-18)	+--------+--------+----*----+---- GAAGAGAATATTGTAAATATAAAAGTTTAACTGTT
Flanking genome sequence (104897 - 104946)	----+--------+--------+--------+--------+----* GGTTGTGCCTGCTCTGTTGTGGGGAGGGCGGTCTCTAAAGAAACAAGCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	7259008	7263903	3	99.0	Perfect prediction

Primer_f	: TCTTCCACTGACACCCAAATC
Primer_r	: CCAATTCTGAGGGCATCTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1366

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information