HUGE |
Gene/Protein Characteristic Table for KIAA1465 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00844 |
---|---|
Accession No. : | AB040898 |
Description : | immunoglobulin superfamily containing leucine-rich repeat 2. |
HUGO Gene Name : | immunoglobulin superfamily containing leucine-rich repeat 2 (ISLR2) |
Clone Name : | fh13187 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1465 |
Source : | Human fetal brain |
Note : | We replaced fj00601, former representative clones for KIAA1465 with fh13187. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4815 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1808 bp Genome contig ID gi51511731f_72108768 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CGCGTCTGTATGCAGTCAATAAAACAATCGATTTGFlanking genome sequence
(107428 - 107477) ----+----*----+----*----+----*----+----*----+----*
AACTGGGCTCGGTGACTTTTTGTCAGGGGACAGAGGGAGGAGGCCTGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 72208768 72216194 4 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 785 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGTTACACTGCATCGCCGACG | |
: GCGTCAGCAAATCCCCATCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: CCR | |
: TGTTACACTGCATCGCCGACG | |
: GCGTCAGCAAATCCCCATCTC | |
: 162 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |