HUGE |
Gene/Protein Characteristic Table for KIAA1904 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00946 |
---|---|
Accession No. : | AB067491 |
Description : | Leucine-rich repeat and fibronectin type-III domain-containing protein 6 precursor. |
HUGO Gene Name : | extracellular leucine-rich repeat and fibronectin type III domain containing 2 (ELFN2) |
Clone Name : | af00058 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1904 |
Source : | Human brain (amygdala) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7579 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5111 bp Genome contig ID gi89161203r_35993947 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TTTCTATATTTGCAATAAATTTCTTATTTAAAGCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACGGGGCCATGGTCTATGCTGTATTCCTCCCACATTGCACTGCCATGACG
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 36093947 36101525 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 821 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACGCCTCTACTAGCAGCTTTG | |
: ATGGCACTAGCTTTCCTGGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |