HUGE

Gene/Protein Characteristic Table for KIAA1484

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05868
Accession No. :	AB040917
Description :	leucine rich repeat and fibronectin type III domain containing 1.
HUGO Gene Name :	leucine rich repeat and fibronectin type III domain containing 1 (LRFN1)
Clone Name :	fj06928 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3174 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1069 bp

Genome contig ID gi42406306r_44389048
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGAATAATCACAAAAATAAAATGATCATAATAGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACGCTTAGTGAATACTTACTTACTATGTGCCAAGCACTTAAGTCATTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 44489048 44497605 2 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 700 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P244	100.0	Leucine-rich re...	Homo sapiens
XP_512991	99.7	similar to leuc...	Pan troglodytes
XP_001087094	97.1	similar to leuc...	Macaca mulatta
Q2WF71	95.3	Leucine-rich re...	Mus musculus
AAZ20639	95.2	SALM2 [Mus musc...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033072	2.8e-47	47.8	KIAA1246
D86983	3.4e-09	31.8	KIAA0230
AB040902	1.8e-05	24.1	KIAA1469
AB020725	3.2e-05	30.3	KIAA0918
AB018349	8.7e-05	25.7	KIAA0806

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 93 106 PR00019 Leucine-rich repeat

IPR001611 138 151 PR00019 Leucine-rich repeat

HMMPfam IPR001611 19 41 PF00560 Leucine-rich repeat

IPR001611 43 65 PF00560 Leucine-rich repeat

IPR001611 67 89 PF00560 Leucine-rich repeat

IPR001611 92 114 PF00560 Leucine-rich repeat

IPR001611 116 138 PF00560 Leucine-rich repeat

IPR013098 228 316 PF07679 Immunoglobulin I-set

IPR003961 355 431 PF00041 Fibronectin

HMMSmart IPR003591 17 40 SM00369 Leucine-rich repeat

IPR003591 41 64 SM00369 Leucine-rich repeat

IPR003591 65 88 SM00369 Leucine-rich repeat

IPR003591 90 113 SM00369 Leucine-rich repeat

IPR003591 114 137 SM00369 Leucine-rich repeat

IPR003591 138 162 SM00369 Leucine-rich repeat

IPR000483 181 226 SM00082 Cysteine-rich flanking region

IPR003599 235 317 SM00409 Immunoglobulin subtype

IPR003598 241 306 SM00408 Immunoglobulin subtype 2

IPR003961 351 431 SM00060 Fibronectin

ProfileScan IPR007110 228 315 PS50835 Immunoglobulin-like

IPR003961 350 441 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	93	106	PR00019	Leucine-rich repeat
IPR001611	138	151	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	19	41	PF00560	Leucine-rich repeat
IPR001611	43	65	PF00560	Leucine-rich repeat
IPR001611	67	89	PF00560	Leucine-rich repeat
IPR001611	92	114	PF00560	Leucine-rich repeat
IPR001611	116	138	PF00560	Leucine-rich repeat
IPR013098	228	316	PF07679	Immunoglobulin I-set
IPR003961	355	431	PF00041	Fibronectin
HMMSmart	IPR003591	17	40	SM00369	Leucine-rich repeat
IPR003591	41	64	SM00369	Leucine-rich repeat
IPR003591	65	88	SM00369	Leucine-rich repeat
IPR003591	90	113	SM00369	Leucine-rich repeat
IPR003591	114	137	SM00369	Leucine-rich repeat
IPR003591	138	162	SM00369	Leucine-rich repeat
IPR000483	181	226	SM00082	Cysteine-rich flanking region
IPR003599	235	317	SM00409	Immunoglobulin subtype
IPR003598	241	306	SM00408	Immunoglobulin subtype 2
IPR003961	351	431	SM00060	Fibronectin
ProfileScan	IPR007110	228	315	PS50835	Immunoglobulin-like
IPR003961	350	441	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 464 TMIIAIGGVIVASVLVFIVLLMI 486 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	464	TMIIAIGGVIVASVLVFIVLLMI	486	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGACCAGGTGCCAACGATTC

Primer_r
: CGAGGGAGTCATCAACGGAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: CCR
Primer_f	: CAGACCAGGTGCCAACGATTC
Primer_r	: CGAGGGAGTCATCAACGGAAC
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1069 bp
Genome contig ID	gi42406306r_44389048
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGAATAATCACAAAAATAAAATGATCATAATAGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACGCTTAGTGAATACTTACTTACTATGTGCCAAGCACTTAAGTCATTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	44489048	44497605	2	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1484

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information