HUGE |
Gene/Protein Characteristic Table for KIAA1675 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01176 |
---|---|
Accession No. : | AB051462 |
Description : | PR domain zinc finger protein 16. |
HUGO Gene Name : | PR domain containing 16 (PRDM16) |
Clone Name : | ae00102 [Vector Info] |
Flexi ORF Clone : | pF1KA1675
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced fg05423, former representative clones for KIAA1675 with ae00102. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8671 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4808 bp Genome contig ID gi89161185f_2875652 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGAGATTGATATGCAATAAATCTGTGTGCTTTTCTFlanking genome sequence
(469393 - 469442) ----+----*----+----*----+----*----+----*----+----*
AAGCCTCGGTGCCCGCGAGCTTCATTGAGGGAGAGGCCCCAGGCCTGTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 2975652 3345043 17 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1286 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTAATACGGAAATCGCTGTGG | |
: TAACCTCCAAATCGGCTTCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CTCTTATTGCGCCAGGGTGAC | |
: GGTGAAAAGTATAGGGTAGGC | |
: 147 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |