HUGE

Gene/Protein Characteristic Table for KIAA1675

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01176
Accession No. :	AB051462
Description :	PR domain zinc finger protein 16.
HUGO Gene Name :	PR domain containing 16 (PRDM16)
Clone Name :	ae00102 [Vector Info]
Flexi ORF Clone :	pF1KA1675
Source :	Human brain (amygdala)
Note :	We replaced fg05423, former representative clones for KIAA1675 with ae00102. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8671 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4808 bp

Genome contig ID gi89161185f_2875652
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGAGATTGATATGCAATAAATCTGTGTGCTTTTCT
Flanking genome sequence
(469393 - 469442)
----+----*----+----*----+----*----+----*----+----*
AAGCCTCGGTGCCCGCGAGCTTCATTGAGGGAGAGGCCCCAGGCCTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 2975652 3345043 17 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1286 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HAZ2	100.0	PR domain zinc ...	Homo sapiens
CAH71132	99.9	PR domain conta...	Homo sapiens
NP_071397	99.8	PR domain conta...	Homo sapiens
CAH71134	99.8	PR domain conta...	Homo sapiens
AAG33382	99.5	PR-domain-conta...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075862	2.3e-10	34.8	KIAA1982
AB075842	2.8e-10	36.5	KIAA1962
AB058730	3.1e-10	38.7	KIAA1827
AB095924	3.5e-10	36.1	KIAA2003
AB051497	7.8e-10	33.3	KIAA1710

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 319 338 PD000003 Zinc finger

IPR007087 376 399 PD000003 Zinc finger

IPR007087 961 984 PD000003 Zinc finger

IPR007087 989 1012 PD000003 Zinc finger

HMMPfam IPR007087 240 263 PF00096 Zinc finger

IPR007087 291 313 PF00096 Zinc finger

IPR007087 319 341 PF00096 Zinc finger

IPR007087 347 370 PF00096 Zinc finger

IPR007087 376 398 PF00096 Zinc finger

IPR007087 404 426 PF00096 Zinc finger

IPR007087 433 455 PF00096 Zinc finger

IPR007087 961 983 PF00096 Zinc finger

IPR007087 989 1012 PF00096 Zinc finger

IPR007087 1018 1040 PF00096 Zinc finger

HMMSmart IPR001214 94 227 SM00317 SET

IPR015880 240 260 SM00355 Zinc finger

IPR015880 291 313 SM00355 Zinc finger

IPR015880 319 341 SM00355 Zinc finger

IPR015880 347 370 SM00355 Zinc finger

IPR015880 376 398 SM00355 Zinc finger

IPR015880 404 426 SM00355 Zinc finger

IPR015880 433 460 SM00355 Zinc finger

IPR015880 961 983 SM00355 Zinc finger

IPR015880 989 1012 SM00355 Zinc finger

IPR015880 1018 1040 SM00355 Zinc finger

ProfileScan IPR001214 93 225 PS50280 SET

IPR007087 240 267 PS50157 Zinc finger

IPR007087 291 318 PS50157 Zinc finger

IPR007087 319 346 PS50157 Zinc finger

IPR007087 347 375 PS50157 Zinc finger

IPR007087 376 403 PS50157 Zinc finger

IPR007087 404 431 PS50157 Zinc finger

IPR007087 433 460 PS50157 Zinc finger

IPR007087 961 988 PS50157 Zinc finger

IPR007087 989 1017 PS50157 Zinc finger

IPR007087 1018 1045 PS50157 Zinc finger

ScanRegExp IPR007087 293 313 PS00028 Zinc finger

IPR007087 321 341 PS00028 Zinc finger

IPR007087 349 370 PS00028 Zinc finger

IPR007087 378 398 PS00028 Zinc finger

IPR007087 406 426 PS00028 Zinc finger

IPR007087 963 983 PS00028 Zinc finger

IPR007087 991 1012 PS00028 Zinc finger

IPR007087 1020 1042 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	319	338	PD000003	Zinc finger
IPR007087	376	399	PD000003	Zinc finger
IPR007087	961	984	PD000003	Zinc finger
IPR007087	989	1012	PD000003	Zinc finger
HMMPfam	IPR007087	240	263	PF00096	Zinc finger
IPR007087	291	313	PF00096	Zinc finger
IPR007087	319	341	PF00096	Zinc finger
IPR007087	347	370	PF00096	Zinc finger
IPR007087	376	398	PF00096	Zinc finger
IPR007087	404	426	PF00096	Zinc finger
IPR007087	433	455	PF00096	Zinc finger
IPR007087	961	983	PF00096	Zinc finger
IPR007087	989	1012	PF00096	Zinc finger
IPR007087	1018	1040	PF00096	Zinc finger
HMMSmart	IPR001214	94	227	SM00317	SET
IPR015880	240	260	SM00355	Zinc finger
IPR015880	291	313	SM00355	Zinc finger
IPR015880	319	341	SM00355	Zinc finger
IPR015880	347	370	SM00355	Zinc finger
IPR015880	376	398	SM00355	Zinc finger
IPR015880	404	426	SM00355	Zinc finger
IPR015880	433	460	SM00355	Zinc finger
IPR015880	961	983	SM00355	Zinc finger
IPR015880	989	1012	SM00355	Zinc finger
IPR015880	1018	1040	SM00355	Zinc finger
ProfileScan	IPR001214	93	225	PS50280	SET
IPR007087	240	267	PS50157	Zinc finger
IPR007087	291	318	PS50157	Zinc finger
IPR007087	319	346	PS50157	Zinc finger
IPR007087	347	375	PS50157	Zinc finger
IPR007087	376	403	PS50157	Zinc finger
IPR007087	404	431	PS50157	Zinc finger
IPR007087	433	460	PS50157	Zinc finger
IPR007087	961	988	PS50157	Zinc finger
IPR007087	989	1017	PS50157	Zinc finger
IPR007087	1018	1045	PS50157	Zinc finger
ScanRegExp	IPR007087	293	313	PS00028	Zinc finger
IPR007087	321	341	PS00028	Zinc finger
IPR007087	349	370	PS00028	Zinc finger
IPR007087	378	398	PS00028	Zinc finger
IPR007087	406	426	PS00028	Zinc finger
IPR007087	963	983	PS00028	Zinc finger
IPR007087	991	1012	PS00028	Zinc finger
IPR007087	1020	1042	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAATACGGAAATCGCTGTGG

Primer_r
: TAACCTCCAAATCGGCTTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCTTATTGCGCCAGGGTGAC
Primer_r	: GGTGAAAAGTATAGGGTAGGC
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4808 bp
Genome contig ID	gi89161185f_2875652
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAGATTGATATGCAATAAATCTGTGTGCTTTTCT
Flanking genome sequence (469393 - 469442)	----+--------+--------+--------+--------+----* AAGCCTCGGTGCCCGCGAGCTTCATTGAGGGAGAGGCCCCAGGCCTGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	2975652	3345043	17	99.3	Perfect prediction

Primer_f	: TTAATACGGAAATCGCTGTGG
Primer_r	: TAACCTCCAAATCGGCTTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1675

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information