HUGE

Gene/Protein Characteristic Table for KIAA1880

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00293
Accession No. :	AB067467
Description :	BTB/POZ domain-containing protein 9.
HUGO Gene Name :	BTB (POZ) domain containing 9 (BTBD9)
Clone Name :	ah02167 [Vector Info]
Flexi ORF Clone :	pF1KA1880
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 5582 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3501 bp

Genome contig ID gi89161210r_38147071
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAAGAGTAGGATGTTTGTTAAACTGATTCCTTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAGAAAAAAAGCTTTTGAATTGTGCAAAAAATTGCCCAGTATTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 38247071 38715568 14 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 642 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001117064	98.1	BTB (POZ) domai...	Macaca mulatta
EAX03959	99.2	BTB (POZ) domai...	Homo sapiens
XP_001495845	98.7	similar to BTB ...	Equus caballus
Q96Q07	100.0	BTB/POZ domain-...	Homo sapiens
XP_538898	96.5	similar to BTB/...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023169	1.5e-12	28.9	KIAA0952
AB032955	4.9e-12	25.3	KIAA1129
AB007938	1.5e-10	28.9	KIAA0469
AB051474	4e-09	24.2	KIAA1687
AB067487	5.1e-09	29.1	KIAA1900

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 56 167 PF00651 BTB/POZ

IPR011705 172 270 PF07707 BTB/Kelch-associated

IPR000421 352 435 PF00754 Coagulation factor 5/8 type

HMMSmart IPR000210 66 167 SM00225 BTB/POZ-like

ProfileScan IPR000210 66 134 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	56	167	PF00651	BTB/POZ
IPR011705	172	270	PF07707	BTB/Kelch-associated
IPR000421	352	435	PF00754	Coagulation factor 5/8 type
HMMSmart	IPR000210	66	167	SM00225	BTB/POZ-like
ProfileScan	IPR000210	66	134	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAAAGTGCGATCTGAGAGCC

Primer_r
: GCAGTCATCATCAATTGGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3501 bp
Genome contig ID	gi89161210r_38147071
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAGAGTAGGATGTTTGTTAAACTGATTCCTTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGAGAAAAAAAGCTTTTGAATTGTGCAAAAAATTGCCCAGTATTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	38247071	38715568	14	99.1	Perfect prediction

Primer_f	: TTAAAGTGCGATCTGAGAGCC
Primer_r	: GCAGTCATCATCAATTGGGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1880

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information