HUGE

Gene/Protein Characteristic Table for KIAA0952

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00694
Accession No. :	AB023169
Description :	BTB/POZ domain-containing protein 3.
HUGO Gene Name :	BTB (POZ) domain containing 3 (BTBD3)
Clone Name :	hj05359 [Vector Info]
Flexi ORF Clone :	pF1KSDA0952
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4856 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2928 bp

Genome contig ID gi51511747f_11746567
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TAATCATGTTAAATGCAAATAAAACTAGTTCATAG
Flanking genome sequence
(108677 - 108726)
----+----*----+----*----+----*----+----*----+----*
ATTTGTTTTCCTTTAGTGCTTTTGTCACACCCTTGAGATAGTAAAAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 11846565 11855242 4 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 539 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2F9	100.0	BTB/POZ domain-...	Homo sapiens
XP_001492736	98.9	BTB (POZ) domai...	Equus caballus
XP_534344	98.1	similar to BTB/...	Canis lupus fam...
EDL80315	96.6	BTB (POZ) domai...	Rattus norvegicus
AAH62968	96.2	BTB (POZ) domai...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067467	8.2e-14	29.3	KIAA1880
AB037799	6.9e-10	24.7	KIAA1378
D50922	4e-09	23.6	KIAA0132
AB032955	3.4e-08	24.3	KIAA1129
AB051474	1.5e-07	23.5	KIAA1687

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 132 237 PF00651 BTB/POZ

IPR012983 393 539 PF08005 PHR

HMMSmart IPR000210 137 237 SM00225 BTB/POZ-like

ProfileScan IPR000210 137 207 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	132	237	PF00651	BTB/POZ
IPR012983	393	539	PF08005	PHR
HMMSmart	IPR000210	137	237	SM00225	BTB/POZ-like
ProfileScan	IPR000210	137	207	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAAAGTCGTGTGAAATCCTG

Primer_r
: CTCTCGGTACCAGCCAATCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2928 bp
Genome contig ID	gi51511747f_11746567
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TAATCATGTTAAATGCAAATAAAACTAGTTCATAG
Flanking genome sequence (108677 - 108726)	----+--------+--------+--------+--------+----* ATTTGTTTTCCTTTAGTGCTTTTGTCACACCCTTGAGATAGTAAAAAATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	11846565	11855242	4	99.0	Perfect prediction

Primer_f	: TGAAAGTCGTGTGAAATCCTG
Primer_r	: CTCTCGGTACCAGCCAATCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0952

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information