Gene/Protein Characteristic Table for KIAA0356
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01072
Accession No AB002354
Description pleckstrin homology domain containing, family M (with RUN domain) member 1, transcript variant 1
Clone name hh00006s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5248 bp)
Predicted protein sequence (1058 aa)
Flexi ORF Clone FXC01072
Source Human adult brain
Rouge ID mKIAA0356 by Kazusa Mouse cDNA Project
Note We replaced hh00006, former representative clones for KIAA0356 with hh00006s1. (2002/12/27)
Features of the cloned cDNA sequence
Description

Length: 5248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1058 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y4G2 0 100.0 Pleckstrin homo...
Homo sapiens
XP_001140498 0 99.0 pleckstrin homo...
Pan troglodytes
BAG61171 0 99.8 unnamed protein...
Homo sapiens
XP_001140336 0 92.6 pleckstrin homo...
Pan troglodytes
XP_001140582 0 97.2 pleckstrin homo...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D86979 5e-14 22.6 KIAA0226
AB020649 0.00012 25.1 KIAA0842
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004012 51 185 PF02759 RUN
IPR001849 537 627 PF00169 Pleckstrin-like
HMMSmart IPR004012 120 183 SM00593 RUN
IPR001849 537 629 SM00233 Pleckstrin-like
IPR001849 686 781 SM00233 Pleckstrin-like
IPR002219 989 1042 SM00109 Protein kinase C
ProfileScan IPR004012 43 185 PS50826 RUN
IPR001849 536 627 PS50003 Pleckstrin-like
IPR002219 988 1042 PS50081 Protein kinase C
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ATTCAAAACTCACACGGCAGC
Primer_r TGCATTGACTCTTCCCGCCTC
PCR conditions 95 °C30 sec64 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f ATTCAAAACTCACACGGCAGC
Primer_r TGCATTGACTCTTCCCGCCTC
PCR product length 159 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp