Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01072 |
---|---|
Accession No | AB002354 |
Description | pleckstrin homology domain containing, family M (with RUN domain) member 1, transcript variant 1 |
Clone name | hh00006s1 |
Vector information | |
cDNA sequence | DNA sequence (5248 bp) Predicted protein sequence (1058 aa) |
HaloTag ORF Clone |
FHC01072
|
Flexi ORF Clone | FXC01072 |
Source | Human adult brain |
Rouge ID |
mKIAA0356
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00006, former representative clones for KIAA0356 with hh00006s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004012 | 51 | 185 | PF02759 | RUN |
IPR001849 | 537 | 627 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR004012 | 120 | 183 | SM00593 | RUN |
IPR001849 | 537 | 629 | SM00233 | Pleckstrin-like | |
IPR001849 | 686 | 781 | SM00233 | Pleckstrin-like | |
IPR002219 | 989 | 1042 | SM00109 | Protein kinase C | |
ProfileScan | IPR004012 | 43 | 185 | PS50826 | RUN |
IPR001849 | 536 | 627 | PS50003 | Pleckstrin-like | |
IPR002219 | 988 | 1042 | PS50081 | Protein kinase C |
RT-PCR |
---|
Primer_f | ATTCAAAACTCACACGGCAGC |
---|---|
Primer_r | TGCATTGACTCTTCCCGCCTC |
PCR conditions | 95 °C30 sec64 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATTCAAAACTCACACGGCAGC |
Primer_r | TGCATTGACTCTTCCCGCCTC |
PCR product length | 159 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |