Gene/Protein Characteristic Table for KIAA0389
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01080
Accession No AB002387
Description myosin VI, transcript variant 1
Clone name hj00061
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5212 bp)
Predicted protein sequence (1296 aa)
Flexi ORF Clone FXC01080
Source Human adult brain
Rouge ID mKIAA0389 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5212 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1296 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI19521 0 100.0 myosin VI [Homo...
Homo sapiens
AAK00229 0 99.9 myosin VI [Homo...
Homo sapiens
XP_001145254 0 99.5 myosin VI [Pan ...
Pan troglodytes
EAW48729 0 100.0 myosin VI, isof...
Homo sapiens
XP_853545 0 96.5 similar to Myos...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB032945 1.6e-19 30.5 KIAA1119
AB018270 2.3e-15 31.0 KIAA0727
AB023217 7.3e-12 30.8 KIAA1000
AB020673 4.5e-08 30.9 KIAA0866
AB020672 4.7e-08 28.9 KIAA0865
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 190 220 PD000355 Myosin head
FPrintScan IPR001609 98 117 PR00193 Myosin head
IPR001609 155 180 PR00193 Myosin head
IPR001609 198 225 PR00193 Myosin head
IPR001609 462 490 PR00193 Myosin head
IPR001609 515 543 PR00193 Myosin head
HMMPfam IPR001609 70 770 PF00063 Myosin head
IPR000048 825 845 PF00612 IQ calmodulin-binding region
HMMSmart IPR001609 62 783 SM00242 Myosin head
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GCTGTAATTCCCAAAACTCTC
Primer_r TCAGACCAAAACATTAGTGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f GCTGTAATTCCCAAAACTCTC
Primer_r TCAGACCAAAACATTAGTGCC
PCR product length 253 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp