Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01080 |
---|---|
Accession No | AB002387 |
Description | myosin VI, transcript variant 1 |
Clone name | hj00061 |
Vector information | |
cDNA sequence | DNA sequence (5212 bp) Predicted protein sequence (1296 aa) |
HaloTag ORF Clone |
FHC01080
|
Flexi ORF Clone | FXC01080 |
Source | Human adult brain |
Rouge ID |
mKIAA0389
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001609 | 190 | 220 | PD000355 | Myosin head |
FPrintScan | IPR001609 | 98 | 117 | PR00193 | Myosin head |
IPR001609 | 155 | 180 | PR00193 | Myosin head | |
IPR001609 | 198 | 225 | PR00193 | Myosin head | |
IPR001609 | 462 | 490 | PR00193 | Myosin head | |
IPR001609 | 515 | 543 | PR00193 | Myosin head | |
HMMPfam | IPR001609 | 70 | 770 | PF00063 | Myosin head |
IPR000048 | 825 | 845 | PF00612 | IQ calmodulin-binding region | |
HMMSmart | IPR001609 | 62 | 783 | SM00242 | Myosin head |
RT-PCR |
---|
Primer_f | GCTGTAATTCCCAAAACTCTC |
---|---|
Primer_r | TCAGACCAAAACATTAGTGCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCTGTAATTCCCAAAACTCTC |
Primer_r | TCAGACCAAAACATTAGTGCC |
PCR product length | 253 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |