KIAA0450

Product ID	ORK06389
Accession No	AB007919
Description	phospholipase C, eta 2
Clone name	hj05822
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5450 bp) Predicted protein sequence (1182 aa)
Source	Human adult brain
Rouge ID	mKIAA0450 by Kazusa Mouse cDNA Project
Note	We replaced hg00217, former representative clones for KIAA0450 with hj05822. (2004/1/10)

Length: 5450 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1899 bp
Genome contig ID	gi89161185f_2288758
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AAAACTTATACAACATTAAAATGATACCAAGTCCC
Flanking genome sequence (138069 - 138118)	----+--------+--------+--------+--------+----* TTTCCATTTTTACCTGGTTTTTCACCCCAGGTGTGTGTGGTGTGCATCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	2388758	2426825	22	99.6	Perfect prediction

Length: 1182 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001085197	95.0	phospholipase C...	Macaca mulatta
BAC56930	99.7	FLJ00414 protei...	Homo sapiens
CAX30816	100.0	phospholipase C...	Homo sapiens
O75038	90.5	1-phosphatidyli...	Homo sapiens
EAW56101	100.0	phospholipase C...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028992	7.8e-80	61.5	KIAA1069
AB029015	2.6e-33	37.0	KIAA1092
AB075844	5.2e-27	35.6	KIAA1964
AB011153	2e-13	30.4	KIAA0581
AB040949	5.5e-13	32.5	KIAA1516

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	200	264	PD000012	Calcium-binding EF-hand
	IPR013841	363	512	PD001202	Phosphatidylinositol-specific phospholipase C
	IPR013841	623	772	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	357	375	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	383	403	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	481	498	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	704	725	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	725	743	PR00390	Phosphoinositide-specific phospholipase C
	IPR000008	807	819	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	837	850	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	859	867	PR00360	C2 calcium-dependent membrane targeting
	IPR001192	879	889	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR001849	74	181	PF00169	Pleckstrin-like
	IPR002048	199	227	PF00036	Calcium-binding EF-hand
	IPR002048	247	264	PF00036	Calcium-binding EF-hand
	IPR015359	269	351	PF09279	EF-hand-like
	IPR000909	353	498	PF00388	Phosphatidylinositol-specific phospholipase C
	IPR001711	651	766	PF00387	Phosphatidylinositol-specific phospholipase C
	IPR000008	786	878	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001849	74	183	SM00233	Pleckstrin-like
	IPR002048	199	227	SM00054	Calcium-binding EF-hand
	IPR002048	235	264	SM00054	Calcium-binding EF-hand
	IPR000909	352	497	SM00148	Phosphatidylinositol-specific phospholipase C
	IPR001711	652	766	SM00149	Phosphatidylinositol-specific phospholipase C
	IPR000008	785	893	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR001849	73	181	PS50003	Pleckstrin-like
	IPR002048	195	230	PS50222	Calcium-binding EF-hand
	IPR002048	231	267	PS50222	Calcium-binding EF-hand
	IPR000909	352	497	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001711	652	765	PS50008	Phosphatidylinositol-specific phospholipase C
	IPR000008	771	878	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR002048	208	220	PS00018	Calcium-binding EF-hand

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	GCCAGCAGCTTTAGCCTTTCC
Primer_r	TGGGCGTGTTGTTTGCTCAGG
PCR product length	133 bp
PCR conditions	95 °C15 sec66 °C60 sec35 cycles