KIAA1069

Product ID	ORK06388
Accession No	AB028992
Description	phospholipase C, eta 1
Clone name	hj05486
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5551 bp) Predicted protein sequence (787 aa)
Source	Human adult brain
Rouge ID	mKIAA1069 by Kazusa Mouse cDNA Project

Length: 5551 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3187 bp
Genome contig ID	gi89161205r_156580365
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATTCATGAAAATATAATTAAAACACATTTTTAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGGTGAACTTTTTTTACAATTGAAATTCATATGATGACTATTGAGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	156680365	156784044	20	100.0	Perfect prediction

Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW78749	100.0	phospholipase C...	Homo sapiens
AAW22607	100.0	phospholipase C...	Homo sapiens
Q4KWH8	99.7	1-phosphatidyli...	Homo sapiens
XP_001148875	99.7	phospholipase C...	Pan troglodytes
XP_001149022	99.5	phospholipase C...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007919	2.8e-145	61.5	KIAA0450
AB029015	1.1e-37	37.3	KIAA1092
AB075844	2.4e-34	34.8	KIAA1964
AB040949	8.1e-28	33.6	KIAA1516
AB011153	3.1e-21	30.4	KIAA0581

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	95	364	PD001202	Phosphatidylinositol-specific phospholipase C
BlastProDom	IPR013841	380	505	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	89	107	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	115	135	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	213	230	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	437	458	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	458	476	PR00390	Phosphoinositide-specific phospholipase C
	IPR000008	540	552	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	570	583	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	592	600	PR00360	C2 calcium-dependent membrane targeting
	IPR001192	612	622	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR015359	1	83	PF09279	EF-hand-like
	IPR000909	85	230	PF00388	Phosphatidylinositol-specific phospholipase C
	IPR001711	385	499	PF00387	Phosphatidylinositol-specific phospholipase C
	IPR000008	519	611	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000909	84	229	SM00148	Phosphatidylinositol-specific phospholipase C
	IPR001711	386	499	SM00149	Phosphatidylinositol-specific phospholipase C
	IPR000008	518	626	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000909	84	229	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001711	386	498	PS50008	Phosphatidylinositol-specific phospholipase C
	IPR000008	504	611	PS50004	C2 calcium-dependent membrane targeting

Primer_f	AATTACAGACTGCGAACAACG
Primer_r	ATAGAGTTGCTTGGTTCCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATTACAGACTGCGAACAACG
Primer_r	ATAGAGTTGCTTGGTTCCCTG
PCR product length	179 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles