KIAA0581

Product ID	ORK01979
Accession No	AB011153
Description	phospholipase C, beta 1 (phosphoinositide-specific), transcript variant 1
Clone name	pf10976
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7092 bp) Predicted protein sequence (1218 aa)
HaloTag ORF Clone	FHC01979
Flexi ORF Clone	FXC01979
Source	Human brain (hippocampus)
Rouge ID	mKIAA0581 by Kazusa Mouse cDNA Project
Note	We replaced hj00610 and hj00610s1, former representative clones for KIAA0581 with pf10976. (2002/5/10,2002/5/10)

Length: 7092 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3054 bp
Genome contig ID	gi51511747f_7960912
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CCAAAGGAAAGAATAAAAATTTCTTAACACAACCC
Flanking genome sequence (852640 - 852689)	----+--------+--------+--------+--------+----* AGCGGTTATTTCTTGGGGTCAGAGTCAACCTTCTTTTGACAGGGAAAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	8060912	8813550	32	99.5	Perfect prediction

Length: 1218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NQ66	100.0	1-phosphatidyli...	Homo sapiens
XP_001116017	99.2	similar to phos...	Macaca mulatta
XP_001170216	99.7	phosphoinositid...	Pan troglodytes
P10894	97.5	1-phosphatidyli...	Bos taurus
1611219A	97.4	phospholipase C...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040949	3.6e-14	27.7	KIAA1516
AB007919	6.4e-14	30.5	KIAA0450
AB029015	2e-12	31.0	KIAA1092
AB028992	5.4e-11	30.5	KIAA1069
AB075844	7e-11	30.9	KIAA1964

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	329	654	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	323	341	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	349	369	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	453	470	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	596	617	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	617	635	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	764	774	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR015359	226	317	PF09279	EF-hand-like
	IPR000909	319	470	PF00388	Phosphatidylinositol-specific phospholipase C
	IPR001711	541	658	PF00387	Phosphatidylinositol-specific phospholipase C
	IPR000008	680	763	PF00168	C2 calcium-dependent membrane targeting
	IPR014815	999	1191	PF08703	PLC-beta
HMMSmart	IPR000909	318	469	SM00148	Phosphatidylinositol-specific phospholipase C
	IPR001711	542	658	SM00149	Phosphatidylinositol-specific phospholipase C
	IPR000008	679	778	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000909	318	469	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001711	542	658	PS50008	Phosphatidylinositol-specific phospholipase C
	IPR000008	665	763	PS50004	C2 calcium-dependent membrane targeting

Primer_f	TGATGGATTGGACGTTGTGAC
Primer_r	CAAGTGGAAGAAACATCATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGGGCCATTTGCTTGCATTAC
Primer_r	TCACAACGTCCAATCCATCAC
PCR product length	85 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles