KIAA1964

Product ID	ORK06387
Accession No	AB075844
Description	phospholipase C, delta 3
Clone name	ph00746
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5926 bp) Predicted protein sequence (757 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1964 by Kazusa Mouse cDNA Project

Length: 5926 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3651 bp
Genome contig ID	gi51511734r_40441861
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTTTATTAGAAACAAGTGAGATGTATTGAGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAACAATGCATTTGGTATTTCCTCCCCGACCCTGGAAATGGATGCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	40541861	40565208	15	99.3	Perfect prediction

Length: 757 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N3E9	100.0	1-phosphatidyli...	Homo sapiens
CAD39054	99.9	hypothetical pr...	Homo sapiens
XP_001115230	98.3	similar to phos...	Macaca mulatta
XP_001142960	95.5	phospholipase C...	Pan troglodytes
XP_001917291	93.3	similar to 1-ph...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029015	3.8e-60	37.2	KIAA1092
AB007919	9.1e-42	35.6	KIAA0450
AB028992	3.7e-28	35.0	KIAA1069
AB040949	1.1e-20	30.5	KIAA1516
AB011153	5.2e-17	30.6	KIAA0581

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	316	600	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	310	328	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	336	356	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	434	451	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	550	571	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	571	589	PR00390	Phosphoinositide-specific phospholipase C
	IPR000008	648	660	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	678	691	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	700	708	PR00360	C2 calcium-dependent membrane targeting
	IPR001192	721	731	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR015359	223	304	PF09279	EF-hand-like
	IPR000909	306	451	PF00388	Phosphatidylinositol-specific phospholipase C
	IPR001711	495	612	PF00387	Phosphatidylinositol-specific phospholipase C
	IPR000008	630	720	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001849	33	142	SM00233	Pleckstrin-like
	IPR000909	305	450	SM00148	Phosphatidylinositol-specific phospholipase C
	IPR001711	496	612	SM00149	Phosphatidylinositol-specific phospholipase C
	IPR000008	629	735	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000909	305	450	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001711	496	612	PS50008	Phosphatidylinositol-specific phospholipase C
	IPR000008	615	720	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR002048	199	211	PS00018	Calcium-binding EF-hand

Primer_f	CGGATGAACTCAGCCAACTAC
Primer_r	AGGCAGGTTTTAGGACGTAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-