KIAA1516

Product ID	ORK01171
Accession No	AB040949
Description	phospholipase C, epsilon 1, transcript variant 1
Clone name	fh10631s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7989 bp) Predicted protein sequence (2304 aa)
HaloTag ORF Clone	FHC01171
Flexi ORF Clone	FXC01171
Source	Human fetal brain
Rouge ID	mKIAA1516 by Kazusa Mouse cDNA Project
Note	We replaced fh10631, former representative clones for KIAA1516 with fh10631s2. (2003/8/28)

Length: 7989 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	446 bp
Genome contig ID	gi89161187f_95643800
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GCTGTATTCCAATAAAACTTTATTTATGGACACTG
Flanking genome sequence (434338 - 434387)	----+--------+--------+--------+--------+----* AAATTGGAATTTCATATATTTTTCACATGTCACAAATACTCTTGTTTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	95743736	96078136	33	100.0	Perfect prediction

Length: 2304 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51855	100.0	Phospholipase C...	Homo sapiens
Q9P212	100.0	1-phosphatidyli...	Homo sapiens
CAH70739	100.0	phospholipase C...	Homo sapiens
AAG17145	99.9	phosphoinositid...	Homo sapiens
XP_001149565	99.3	pancreas-enrich...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028992	9.4e-25	33.6	KIAA1069
AB011153	5.3e-24	27.6	KIAA0581
AB007919	6.7e-23	32.6	KIAA0450
AB075844	1.1e-22	30.5	KIAA1964
AB029015	6.2e-22	27.9	KIAA1092

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	1405	1569	PD001202	Phosphatidylinositol-specific phospholipase C
BlastProDom	IPR013841	1752	1844	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	1399	1417	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	1425	1445	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	1526	1543	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	1786	1807	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	1807	1825	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	1956	1966	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR001895	553	727	PF00617	Guanine-nucleotide dissociation stimulator CDC25
	IPR015359	1330	1381	PF09279	EF-hand-like
	IPR000909	1395	1543	PF00388	Phosphatidylinositol-specific phospholipase C
	IPR001711	1756	1848	PF00387	Phosphatidylinositol-specific phospholipase C
	IPR000008	1873	1947	PF00168	C2 calcium-dependent membrane targeting
	IPR000159	2137	2240	PF00788	Ras-association
HMMSmart	IPR001895	530	833	SM00147	Guanine-nucleotide dissociation stimulator CDC25
	IPR000909	1394	1542	SM00148	Phosphatidylinositol-specific phospholipase C
	IPR001711	1731	1848	SM00149	Phosphatidylinositol-specific phospholipase C
	IPR000008	1872	1970	SM00239	C2 calcium-dependent membrane targeting
	IPR000159	2137	2240	SM00314	Ras-association
ProfileScan	IPR001895	533	792	PS50009	Guanine-nucleotide dissociation stimulator CDC25
	IPR000909	1394	1542	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001711	1757	1847	PS50008	Phosphatidylinositol-specific phospholipase C
	IPR000008	1862	1946	PS50004	C2 calcium-dependent membrane targeting
	IPR000159	2137	2240	PS50200	Ras-association

Primer_f	CAAGAAGCTCACCAAGTCAAC
Primer_r	CTGTCGGTAATCCATTGTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-