Order Kazusa clone(s) from : ![]() |
Product ID | ORK00737 |
---|---|
Accession No | AB029015 |
Description | phospholipase C-like 2, transcript variant 1 |
Clone name | hk04417 |
Vector information | |
cDNA sequence | DNA sequence (4147 bp) Predicted protein sequence (1154 aa) |
HaloTag ORF Clone |
FHC00737
![]() |
Flexi ORF Clone | FXC00737 |
Source | Human adult brain |
Rouge ID |
mKIAA1092
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 682 bp |
---|---|
Genome contig ID | gi89161205f_16801567 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (305525 - 305574) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 16901456 | 17107090 | 6 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR013841 | 464 | 749 | PD001202 | Phosphatidylinositol-specific phospholipase C |
FPrintScan | IPR001192 | 458 | 476 | PR00390 | Phosphoinositide-specific phospholipase C |
IPR001192 | 484 | 504 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR001192 | 581 | 598 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR001192 | 699 | 720 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR001192 | 720 | 738 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR000008 | 802 | 814 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 832 | 845 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR001192 | 874 | 884 | PR00390 | Phosphoinositide-specific phospholipase C | |
HMMPfam | IPR001849 | 169 | 278 | PF00169 | Pleckstrin-like |
IPR015359 | 370 | 452 | PF09279 | EF-hand-like | |
IPR000909 | 454 | 598 | PF00388 | Phosphatidylinositol-specific phospholipase C | |
IPR001711 | 644 | 761 | PF00387 | Phosphatidylinositol-specific phospholipase C | |
IPR000008 | 783 | 873 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR001849 | 169 | 280 | SM00233 | Pleckstrin-like |
IPR000909 | 453 | 597 | SM00148 | Phosphatidylinositol-specific phospholipase C | |
IPR001711 | 645 | 761 | SM00149 | Phosphatidylinositol-specific phospholipase C | |
IPR000008 | 782 | 888 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR001849 | 168 | 278 | PS50003 | Pleckstrin-like |
IPR000909 | 453 | 597 | PS50007 | Phosphatidylinositol-specific phospholipase C | |
IPR001711 | 645 | 761 | PS50008 | Phosphatidylinositol-specific phospholipase C | |
IPR000008 | 768 | 873 | PS50004 | C2 calcium-dependent membrane targeting |
![]() |
Primer_f | CCCAATAATGTGCCTGTGAAG |
---|---|
Primer_r | TTTCATTGGCGTACTTGCTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAGAGAATGTAAGTGGACGGG |
Primer_r | ATGTATCTTCAGCCAGGGAGC |
PCR product length | 101 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |