Gene/Protein Characteristic Table for KIAA0478
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00546
Accession No AB007947
Description zinc finger and BTB domain containing 40, transcript variant 2
Clone name hh05955
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6028 bp)
Predicted protein sequence (1253 aa)
Flexi ORF Clone FXC00546
Source Human adult brain
Rouge ID mKIAA0478 by Kazusa Mouse cDNA Project
Note We replaced hh00573, former representative clones for KIAA0478 with hh05955. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 6028 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2091 bp
Genome contig ID gi89161185f_22550953
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
AAAACTCTTCGGAATAAAGAGGGCTGTAAATTTTG
Flanking genome sequence
(176616 - 176665)		 
----+----*----+----*----+----*----+----*----+----*
AATTCCAGTGTCAGATCCTTTCAAGCACTGAGAAATTCTTTCTCAGGTTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 f 22650947 22727567 18 99.4 Terminal No-hit
Features of the protein sequence
Description

Length: 1253 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG09748 0 100.0 zinc finger and...
 synthetic construct
EAW95012 0 99.9 zinc finger and...
 Homo sapiens
Q9NUA8 0 99.8 Zinc finger and...
 Homo sapiens
XP_001164955 0 98.6 zinc finger and...
 Pan troglodytes
XP_001101193 0 96.2 similar to zinc...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046808 5.1e-17 32.7 KIAA1588
AB046831 2.1e-16 33.7 KIAA1611
AB095928 2.4e-16 30.4 KIAA2007
AB058777 1.3e-15 28.5 KIAA1874
AB023178 1.8e-15 31.5 KIAA0961
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013069 28 131 PF00651 BTB/POZ
IPR007087 821 844 PF00096 Zinc finger
IPR007087 850 872 PF00096 Zinc finger
IPR007087 878 901 PF00096 Zinc finger
IPR007087 907 929 PF00096 Zinc finger
IPR007087 935 958 PF00096 Zinc finger
IPR007087 992 1014 PF00096 Zinc finger
IPR007087 1020 1042 PF00096 Zinc finger
IPR007087 1118 1141 PF00096 Zinc finger
IPR007087 1149 1172 PF00096 Zinc finger
HMMSmart IPR000210 38 131 SM00225 BTB/POZ-like
IPR015880 750 770 SM00355 Zinc finger
IPR015880 780 803 SM00355 Zinc finger
IPR015880 821 844 SM00355 Zinc finger
IPR015880 850 872 SM00355 Zinc finger
IPR015880 878 901 SM00355 Zinc finger
IPR015880 907 929 SM00355 Zinc finger
IPR015880 935 958 SM00355 Zinc finger
IPR015880 964 987 SM00355 Zinc finger
IPR015880 992 1014 SM00355 Zinc finger
IPR015880 1020 1042 SM00355 Zinc finger
IPR015880 1060 1083 SM00355 Zinc finger
IPR015880 1089 1112 SM00355 Zinc finger
IPR015880 1118 1141 SM00355 Zinc finger
IPR015880 1149 1172 SM00355 Zinc finger
ProfileScan IPR000210 38 101 PS50097 BTB/POZ-like
IPR007087 821 849 PS50157 Zinc finger
IPR007087 850 877 PS50157 Zinc finger
IPR007087 878 906 PS50157 Zinc finger
IPR007087 907 934 PS50157 Zinc finger
IPR007087 935 963 PS50157 Zinc finger
IPR007087 964 992 PS50157 Zinc finger
IPR007087 992 1019 PS50157 Zinc finger
IPR007087 1020 1042 PS50157 Zinc finger
IPR007087 1060 1088 PS50157 Zinc finger
IPR007087 1089 1117 PS50157 Zinc finger
IPR007087 1149 1172 PS50157 Zinc finger
ScanRegExp IPR007087 823 844 PS00028 Zinc finger
IPR007087 852 872 PS00028 Zinc finger
IPR007087 880 901 PS00028 Zinc finger
IPR007087 909 929 PS00028 Zinc finger
IPR007087 937 958 PS00028 Zinc finger
IPR007087 966 987 PS00028 Zinc finger
IPR007087 994 1014 PS00028 Zinc finger
IPR007087 1022 1043 PS00028 Zinc finger
IPR007087 1062 1083 PS00028 Zinc finger
IPR007087 1091 1112 PS00028 Zinc finger
IPR007087 1120 1141 PS00028 Zinc finger
IPR007087 1151 1172 PS00028 Zinc finger
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f GCAAGCTGAACAAGAATATGG
Primer_r TGGGGACTACATTGCTGAAGG
PCR product length 186 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp