Order Kazusa clone(s) from : ![]() |
Product ID | ORK04211 |
---|---|
Accession No | AB023173 |
Description | ATPase, class VI, type 11B |
Clone name | hj05590 |
Vector information | |
cDNA sequence | DNA sequence (5542 bp) Predicted protein sequence (672 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0956
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3521 bp |
---|---|
Genome contig ID | gi89161205f_183966820 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (155291 - 155340) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 184066820 | 184122109 | 17 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001757 | 193 | 203 | PR00119 | ATPase |
IPR001757 | 314 | 333 | PR00119 | ATPase | |
HMMTigr | IPR006539 | 1 | 602 | TIGR01652 | Phospholipid-translocating P-type ATPase |
IPR001757 | 168 | 218 | TIGR01494 | ATPase | |
IPR001757 | 286 | 394 | TIGR01494 | ATPase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | DEKALVEAAARIGIVFIGNSEET | 47 | SECONDARY | 23 | 2 | 405 | SVYLTLYNICFTSLPILIYSLLE | 427 | SECONDARY | 23 | 3 | 494 | WTFGTLVFTVMVITVTVKMALET | 516 | SECONDARY | 23 | 4 | 527 | TWGSIIFYFVFSLFYGGILWPFL | 549 | PRIMARY | 23 | 5 | 560 | QLLSSGSAWFAIILMVVTCLFLD | 582 | PRIMARY | 23 |
---|
![]() |
Primer_f | GAACTTATCTGATCGCTTGAG |
---|---|
Primer_r | CACGAGATTTTTCAGAGTAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |