KIAA1154

Product ID	ORK00190
Accession No	AB032980
Description	doublecortin domain containing 2, transcript variant 1
Clone name	hh03679s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1251) was subcloned upstream of the cDNA (1252-6548). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGAATTC ACTAGTGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6548 bp) Predicted protein sequence (476 aa)
HaloTag ORF Clone	FHC00190
Flexi ORF Clone	FXC00190
Source	Human adult brain
Rouge ID	mKIAA1154 by Kazusa Mouse cDNA Project
Note	We replaced hh03679, former representative clones for KIAA1154 with hh03679s1. (2002/5/10)

Length: 6548 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5117 bp
Genome contig ID	gi89161210r_24178103
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGAATGTCTCTTTAAGGAAAATTATTTGTATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	24277822	24465957	10	99.2	Perfect prediction

Length: 476 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UHG0	2e-166	99.8	Doublecortin do...	Homo sapiens
AAH50704	2.3e-166	99.8	DCDC2 protein [...	Homo sapiens
XP_001100219	3.7e-160	95.2	doublecortin do...	Macaca mulatta
XP_001495221	2.3e-150	89.3	similar to RU2S...	Equus caballus
XP_001928023	3.6e-148	88.7	similar to RU2S...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002367	3.1e-10	30.6	KIAA0369

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003533	34	95	PF03607	Doublecortin
HMMPfam	IPR003533	156	216	PF03607	Doublecortin
HMMSmart	IPR003533	12	100	SM00537	Doublecortin
HMMSmart	IPR003533	134	221	SM00537	Doublecortin
ProfileScan	IPR003533	17	100	PS50309	Doublecortin
ProfileScan	IPR003533	139	221	PS50309	Doublecortin

Primer_f	TTAGGTTGCCACACTCATAGG
Primer_r	ACTCTGAACCACGTATGTATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-