KIAA1812

Product ID	ORK05717
Accession No	AB058715
Description	cadherin-related 23
Clone name	hh13045
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5974 bp) Predicted protein sequence (803 aa)
Source	Human adult brain

Length: 5974 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3560 bp
Genome contig ID	gi89161187f_72975679
PolyA signal sequence (None)	+--------+--------+----*----+---- AATATTTTCAAAATAATAACAGATTTCACAAAAAT
Flanking genome sequence (170964 - 171013)	----+--------+--------+--------+--------+----* ATATGGGTGCCTGAATTCTCTTGAAATGTCAGAATTTCACCACTGGCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	73075679	73146641	17	99.9	Perfect prediction

Length: 803 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI40838	99.7	cadherin-like 2...	Homo sapiens
EAW54430	98.0	cadherin-like 2...	Homo sapiens
Q9H251	99.9	Cadherin-23; Ot...	Homo sapiens
NP_071407	99.9	cadherin-like 2...	Homo sapiens
CAI13426	99.9	cadherin-like 2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87469	1.6e-36	35.2	KIAA0279
AB053445	2.6e-36	32.0	KIAA1774
AB053446	7.5e-33	31.4	KIAA1773
AB046782	7.3e-28	28.2	KIAA1562
AB002343	1e-21	30.9	KIAA0345

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	51	80	PR00205	Cadherin
	IPR002126	119	131	PR00205	Cadherin
	IPR002126	241	260	PR00205	Cadherin
	IPR002126	260	273	PR00205	Cadherin
	IPR002126	534	560	PR00205	Cadherin
	IPR002126	675	692	PR00205	Cadherin
HMMPfam	IPR002126	56	143	PF00028	Cadherin
	IPR002126	157	253	PF00028	Cadherin
	IPR002126	267	360	PF00028	Cadherin
	IPR002126	374	470	PF00028	Cadherin
	IPR002126	486	577	PF00028	Cadherin
	IPR002126	591	682	PF00028	Cadherin
HMMSmart	IPR002126	73	150	SM00112	Cadherin
	IPR002126	174	260	SM00112	Cadherin
	IPR002126	284	367	SM00112	Cadherin
	IPR002126	391	479	SM00112	Cadherin
	IPR002126	503	584	SM00112	Cadherin
	IPR002126	608	691	SM00112	Cadherin
ProfileScan	IPR002126	4	51	PS50268	Cadherin
	IPR002126	52	152	PS50268	Cadherin
	IPR002126	153	262	PS50268	Cadherin
	IPR002126	263	375	PS50268	Cadherin
	IPR002126	370	481	PS50268	Cadherin
	IPR002126	482	586	PS50268	Cadherin
	IPR002126	587	693	PS50268	Cadherin
ScanRegExp	IPR002126	140	150	PS00232	Cadherin
	IPR002126	250	260	PS00232	Cadherin
	IPR002126	357	367	PS00232	Cadherin
	IPR002126	469	479	PS00232	Cadherin
	IPR002126	681	691	PS00232	Cadherin

Primer_f	CTCACCAAAACCACAGATAGC
Primer_r	CAAGAGGCAGGGCATTTCCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTCACCAAAACCACAGATAGC
Primer_r	CAAGAGGCAGGGCATTTCCAG
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec194 cycles