KIAA1880

Product ID	ORK00293
Accession No	AB067467
Description	BTB (POZ) domain containing 9, transcript variant 1
Clone name	ah02167
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5582 bp) Predicted protein sequence (642 aa)
HaloTag ORF Clone	FHC00293
Flexi ORF Clone	FXC00293
Source	Human brain (amygdala)
Rouge ID	mKIAA1880 by Kazusa Mouse cDNA Project

Length: 5582 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3501 bp
Genome contig ID	gi89161210r_38147071
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAGAGTAGGATGTTTGTTAAACTGATTCCTTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGAGAAAAAAAGCTTTTGAATTGTGCAAAAAATTGCCCAGTATTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	38247071	38715568	14	99.1	Perfect prediction

Length: 642 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001117064	98.1	BTB (POZ) domai...	Macaca mulatta
EAX03959	99.2	BTB (POZ) domai...	Homo sapiens
XP_001495845	98.7	similar to BTB ...	Equus caballus
Q96Q07	100.0	BTB/POZ domain-...	Homo sapiens
XP_538898	96.5	similar to BTB/...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023169	1.5e-12	28.9	KIAA0952
AB032955	4.9e-12	25.3	KIAA1129
AB007938	1.5e-10	28.9	KIAA0469
AB051474	4e-09	24.2	KIAA1687
AB067487	5.1e-09	29.1	KIAA1900

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	56	167	PF00651	BTB/POZ
	IPR011705	172	270	PF07707	BTB/Kelch-associated
	IPR000421	352	435	PF00754	Coagulation factor 5/8 type
HMMSmart	IPR000210	66	167	SM00225	BTB/POZ-like
ProfileScan	IPR000210	66	134	PS50097	BTB/POZ-like

Primer_f	TTAAAGTGCGATCTGAGAGCC
Primer_r	GCAGTCATCATCAATTGGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-