|
Order Kazusa clone(s) from : |
| Product ID | ORK07012 |
|---|---|
| Accession No | AK024504 |
| Clone name | as00113 |
| Vector information | |
| cDNA sequence | DNA sequence (4835 bp) Predicted protein sequence (419 aa) |
| Source | Human spleen |
| Rouge ID |
mFLJ00113
by Kazusa Mouse cDNA Project
|
Length: 4835 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Length: 419 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000719 | 161 | 336 | PD000001 | Protein kinase |
| HMMPfam | IPR000719 | 37 | 330 | PF00069 | Protein kinase |
| HMMSmart | IPR002290 | 37 | 334 | SM00220 | Serine/threonine protein kinase |
| IPR001245 | 37 | 330 | SM00219 | Tyrosine protein kinase | |
| ProfileScan | IPR000719 | 37 | 334 | PS50011 | Protein kinase |
| ScanRegExp | IPR008271 | 195 | 207 | PS00108 | Serine/threonine protein kinase |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | AGCCGGATGGTTAAGAAGATG |
|---|---|
| Primer_r | ATTACCACAGTCTCCCTCTCG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |