Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07012 |
---|---|
Accession No | AK024504 |
Clone name | as00113 |
Vector information | |
cDNA sequence | DNA sequence (4835 bp) Predicted protein sequence (419 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00113
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 161 | 336 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 37 | 330 | PF00069 | Protein kinase |
HMMSmart | IPR002290 | 37 | 334 | SM00220 | Serine/threonine protein kinase |
IPR001245 | 37 | 330 | SM00219 | Tyrosine protein kinase | |
ProfileScan | IPR000719 | 37 | 334 | PS50011 | Protein kinase |
ScanRegExp | IPR008271 | 195 | 207 | PS00108 | Serine/threonine protein kinase |
RT-PCR-ELISA |
Primer_f | AGCCGGATGGTTAAGAAGATG |
---|---|
Primer_r | ATTACCACAGTCTCCCTCTCG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |