Gene/Protein Characteristic Table for FLJ00113
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07012
Accession No AK024504
Clone name as00113
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4835 bp)
Predicted protein sequence (419 aa)
Source Human spleen
Rouge ID mFLJ00113 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4835 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 419 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15794 2.2e-169 100.0 FLJ00113 protei...
Homo sapiens
CAH71864 1.3e-168 100.0 serine/threonin...
Homo sapiens
XP_539592 3.9e-146 98.7 similar to SINK...
Canis lupus fam...
EAX07368 4.6e-145 91.0 serine/threonin...
Homo sapiens
Q8N2I9 2.7e-144 91.0 Serine/threonin...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011109 2.7e-17 40.2 KIAA0537
AB023185 2.3e-15 29.2 KIAA0968
D79997 6.4e-15 31.5 KIAA0175
AB018324 6.9e-15 36.4 KIAA0781
AB023216 1.2e-14 36.4 KIAA0999
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 161 336 PD000001 Protein kinase
HMMPfam IPR000719 37 330 PF00069 Protein kinase
HMMSmart IPR002290 37 334 SM00220 Serine/threonine protein kinase
IPR001245 37 330 SM00219 Tyrosine protein kinase
ProfileScan IPR000719 37 334 PS50011 Protein kinase
ScanRegExp IPR008271 195 207 PS00108 Serine/threonine protein kinase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCCGGATGGTTAAGAAGATG
Primer_r ATTACCACAGTCTCCCTCTCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp