KIAA0931

Product ID	ORK02004
Accession No	AB023148
Description	PH domain and leucine rich repeat protein phosphatase 2
Clone name	bf00159
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8449 bp) Predicted protein sequence (1258 aa)
HaloTag ORF Clone	FHC02004
Flexi ORF Clone	FXC02004
Source	Human adult brain
Note	We replaced hh03806, former representative clones for KIAA0931 with bf00159. (2005/08/06)

Length: 8449 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3952 bp
Genome contig ID	gi51511732r_70136393
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAAGTGGAATCTTTTTCATGGCTTTGTTTT
Flanking genome sequence (99939 - 99890)	----+--------+--------+--------+--------+----* AAAATGGAGTGCTTGTTATTTCATAAGTATTTTAGCATGAAGCTATAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	70236332	70317366	21	99.0	Both No-hit

Length: 1258 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72679	100.0	PH domain and l...	synthetic construct
XP_001105908	98.6	similar to PH d...	Macaca mulatta
Q6ZVD8	94.9	PH domain leuci...	Homo sapiens
AAI29928	94.9	PH domain and l...	Homo sapiens
CAL38419	94.6	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011178	1.5e-81	51.4	KIAA0606
AB020669	1.4e-15	27.1	KIAA0862
D63481	2.4e-11	29.9	KIAA0147
AB033051	5.6e-08	28.0	KIAA1225
AB014544	1e-05	27.8	KIAA0644

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	574	587	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	602	615	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	302	323	PF00560	Leucine-rich repeat
	IPR001611	325	346	PF00560	Leucine-rich repeat
	IPR001611	348	369	PF00560	Leucine-rich repeat
	IPR001611	371	392	PF00560	Leucine-rich repeat
	IPR001611	442	464	PF00560	Leucine-rich repeat
	IPR001611	528	550	PF00560	Leucine-rich repeat
	IPR001611	551	572	PF00560	Leucine-rich repeat
	IPR001611	573	595	PF00560	Leucine-rich repeat
	IPR001611	604	625	PF00560	Leucine-rich repeat
	IPR014045	719	961	PF00481	Protein phosphatase 2C
HMMSmart	NULL	300	319	SM00364	NULL
	NULL	323	342	SM00364	NULL
	IPR003591	323	345	SM00369	Leucine-rich repeat
	NULL	346	365	SM00364	NULL
	IPR003591	346	368	SM00369	Leucine-rich repeat
	NULL	369	388	SM00364	NULL
	IPR003591	369	391	SM00369	Leucine-rich repeat
	IPR003591	461	484	SM00369	Leucine-rich repeat
	IPR003591	502	526	SM00369	Leucine-rich repeat
	NULL	503	522	SM00364	NULL
	NULL	526	545	SM00364	NULL
	IPR003591	527	549	SM00369	Leucine-rich repeat
	NULL	549	568	SM00364	NULL
	IPR003591	551	571	SM00369	Leucine-rich repeat
	IPR003591	574	594	SM00369	Leucine-rich repeat
	NULL	574	590	SM00364	NULL
	IPR003591	602	625	SM00369	Leucine-rich repeat
	NULL	602	621	SM00364	NULL
	NULL	625	644	SM00364	NULL
	IPR003591	647	671	SM00369	Leucine-rich repeat
	IPR001932	710	966	SM00332	Protein phosphatase 2C-related

Primer_f	AGTCAGTCACACATAAGTTCC
Primer_r	GTAAGATATGAGCCCACTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-