Gene/Protein Characteristic Table for KIAA1198
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00199
Accession No AB033024
Description zinc finger protein 490
Clone name fg01911
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6090 bp)
Predicted protein sequence (553 aa)
Flexi ORF Clone FXC00199
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 6090 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 12521826 12582617 14 97.9 Terminal No-hit
Features of the protein sequence
Description

Length: 553 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9ULM2 0 100.0 Zinc finger pro...
Homo sapiens
XP_853801 2.1e-130 61.7 similar to zinc...
Canis lupus fam...
EAW84276 2.3e-127 58.0 zinc finger pro...
Homo sapiens
Q8N972 5.2e-127 60.0 Zinc finger pro...
Homo sapiens
XP_524120 7.3e-127 59.8 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037770 7.5e-58 47.0 KIAA1349
AB046831 1.2e-57 47.0 KIAA1611
AB095928 1.1e-56 42.2 KIAA2007
AB046779 2.1e-56 43.6 KIAA1559
AB075849 2.2e-56 41.8 KIAA1969
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 218 241 PD000003 Zinc finger
IPR007087 246 269 PD000003 Zinc finger
IPR007087 274 297 PD000003 Zinc finger
IPR007087 302 325 PD000003 Zinc finger
IPR007087 330 353 PD000003 Zinc finger
IPR007087 386 408 PD000003 Zinc finger
IPR007087 414 437 PD000003 Zinc finger
IPR007087 442 465 PD000003 Zinc finger
IPR007087 470 493 PD000003 Zinc finger
IPR007087 499 521 PD000003 Zinc finger
IPR007087 526 549 PD000003 Zinc finger
HMMPfam IPR001909 81 121 PF01352 KRAB box
IPR007087 180 202 PF00096 Zinc finger
IPR007087 218 240 PF00096 Zinc finger
IPR007087 246 268 PF00096 Zinc finger
IPR007087 274 296 PF00096 Zinc finger
IPR007087 302 324 PF00096 Zinc finger
IPR007087 330 352 PF00096 Zinc finger
IPR007087 358 380 PF00096 Zinc finger
IPR007087 386 408 PF00096 Zinc finger
IPR007087 414 436 PF00096 Zinc finger
IPR007087 442 464 PF00096 Zinc finger
IPR007087 470 492 PF00096 Zinc finger
IPR007087 498 520 PF00096 Zinc finger
IPR007087 526 548 PF00096 Zinc finger
HMMSmart IPR001909 81 135 SM00349 KRAB box
IPR015880 180 202 SM00355 Zinc finger
IPR015880 218 240 SM00355 Zinc finger
IPR015880 246 268 SM00355 Zinc finger
IPR015880 274 296 SM00355 Zinc finger
IPR015880 302 324 SM00355 Zinc finger
IPR015880 330 352 SM00355 Zinc finger
IPR015880 358 380 SM00355 Zinc finger
IPR015880 386 408 SM00355 Zinc finger
IPR015880 414 436 SM00355 Zinc finger
IPR015880 442 464 SM00355 Zinc finger
IPR015880 470 492 SM00355 Zinc finger
IPR015880 498 520 SM00355 Zinc finger
IPR015880 526 548 SM00355 Zinc finger
ProfileScan IPR001909 81 156 PS50805 KRAB box
IPR007087 180 207 PS50157 Zinc finger
IPR007087 218 245 PS50157 Zinc finger
IPR007087 246 273 PS50157 Zinc finger
IPR007087 274 301 PS50157 Zinc finger
IPR007087 302 329 PS50157 Zinc finger
IPR007087 330 357 PS50157 Zinc finger
IPR007087 358 385 PS50157 Zinc finger
IPR007087 386 413 PS50157 Zinc finger
IPR007087 414 441 PS50157 Zinc finger
IPR007087 442 469 PS50157 Zinc finger
IPR007087 470 497 PS50157 Zinc finger
IPR007087 498 525 PS50157 Zinc finger
IPR007087 526 553 PS50157 Zinc finger
ScanRegExp IPR007087 180 202 PS00028 Zinc finger
IPR007087 220 240 PS00028 Zinc finger
IPR007087 248 268 PS00028 Zinc finger
IPR007087 276 296 PS00028 Zinc finger
IPR007087 304 324 PS00028 Zinc finger
IPR007087 332 352 PS00028 Zinc finger
IPR007087 360 380 PS00028 Zinc finger
IPR007087 388 408 PS00028 Zinc finger
IPR007087 416 436 PS00028 Zinc finger
IPR007087 444 464 PS00028 Zinc finger
IPR007087 472 492 PS00028 Zinc finger
IPR007087 498 520 PS00028 Zinc finger
IPR007087 528 548 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AACCACGGTGAAGATACTAGG
Primer_r CATAAATGTTCCTGGTGAGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp