Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00199 |
---|---|
Accession No | AB033024 |
Description | zinc finger protein 490 |
Clone name | fg01911 |
Vector information | |
cDNA sequence | DNA sequence (6090 bp) Predicted protein sequence (553 aa) |
HaloTag ORF Clone |
FHC00199
|
Flexi ORF Clone | FXC00199 |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 12521826 | 12582617 | 14 | 97.9 | Terminal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 218 | 241 | PD000003 | Zinc finger |
IPR007087 | 246 | 269 | PD000003 | Zinc finger | |
IPR007087 | 274 | 297 | PD000003 | Zinc finger | |
IPR007087 | 302 | 325 | PD000003 | Zinc finger | |
IPR007087 | 330 | 353 | PD000003 | Zinc finger | |
IPR007087 | 386 | 408 | PD000003 | Zinc finger | |
IPR007087 | 414 | 437 | PD000003 | Zinc finger | |
IPR007087 | 442 | 465 | PD000003 | Zinc finger | |
IPR007087 | 470 | 493 | PD000003 | Zinc finger | |
IPR007087 | 499 | 521 | PD000003 | Zinc finger | |
IPR007087 | 526 | 549 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 81 | 121 | PF01352 | KRAB box |
IPR007087 | 180 | 202 | PF00096 | Zinc finger | |
IPR007087 | 218 | 240 | PF00096 | Zinc finger | |
IPR007087 | 246 | 268 | PF00096 | Zinc finger | |
IPR007087 | 274 | 296 | PF00096 | Zinc finger | |
IPR007087 | 302 | 324 | PF00096 | Zinc finger | |
IPR007087 | 330 | 352 | PF00096 | Zinc finger | |
IPR007087 | 358 | 380 | PF00096 | Zinc finger | |
IPR007087 | 386 | 408 | PF00096 | Zinc finger | |
IPR007087 | 414 | 436 | PF00096 | Zinc finger | |
IPR007087 | 442 | 464 | PF00096 | Zinc finger | |
IPR007087 | 470 | 492 | PF00096 | Zinc finger | |
IPR007087 | 498 | 520 | PF00096 | Zinc finger | |
IPR007087 | 526 | 548 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 81 | 135 | SM00349 | KRAB box |
IPR015880 | 180 | 202 | SM00355 | Zinc finger | |
IPR015880 | 218 | 240 | SM00355 | Zinc finger | |
IPR015880 | 246 | 268 | SM00355 | Zinc finger | |
IPR015880 | 274 | 296 | SM00355 | Zinc finger | |
IPR015880 | 302 | 324 | SM00355 | Zinc finger | |
IPR015880 | 330 | 352 | SM00355 | Zinc finger | |
IPR015880 | 358 | 380 | SM00355 | Zinc finger | |
IPR015880 | 386 | 408 | SM00355 | Zinc finger | |
IPR015880 | 414 | 436 | SM00355 | Zinc finger | |
IPR015880 | 442 | 464 | SM00355 | Zinc finger | |
IPR015880 | 470 | 492 | SM00355 | Zinc finger | |
IPR015880 | 498 | 520 | SM00355 | Zinc finger | |
IPR015880 | 526 | 548 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 81 | 156 | PS50805 | KRAB box |
IPR007087 | 180 | 207 | PS50157 | Zinc finger | |
IPR007087 | 218 | 245 | PS50157 | Zinc finger | |
IPR007087 | 246 | 273 | PS50157 | Zinc finger | |
IPR007087 | 274 | 301 | PS50157 | Zinc finger | |
IPR007087 | 302 | 329 | PS50157 | Zinc finger | |
IPR007087 | 330 | 357 | PS50157 | Zinc finger | |
IPR007087 | 358 | 385 | PS50157 | Zinc finger | |
IPR007087 | 386 | 413 | PS50157 | Zinc finger | |
IPR007087 | 414 | 441 | PS50157 | Zinc finger | |
IPR007087 | 442 | 469 | PS50157 | Zinc finger | |
IPR007087 | 470 | 497 | PS50157 | Zinc finger | |
IPR007087 | 498 | 525 | PS50157 | Zinc finger | |
IPR007087 | 526 | 553 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 180 | 202 | PS00028 | Zinc finger |
IPR007087 | 220 | 240 | PS00028 | Zinc finger | |
IPR007087 | 248 | 268 | PS00028 | Zinc finger | |
IPR007087 | 276 | 296 | PS00028 | Zinc finger | |
IPR007087 | 304 | 324 | PS00028 | Zinc finger | |
IPR007087 | 332 | 352 | PS00028 | Zinc finger | |
IPR007087 | 360 | 380 | PS00028 | Zinc finger | |
IPR007087 | 388 | 408 | PS00028 | Zinc finger | |
IPR007087 | 416 | 436 | PS00028 | Zinc finger | |
IPR007087 | 444 | 464 | PS00028 | Zinc finger | |
IPR007087 | 472 | 492 | PS00028 | Zinc finger | |
IPR007087 | 498 | 520 | PS00028 | Zinc finger | |
IPR007087 | 528 | 548 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | AACCACGGTGAAGATACTAGG |
---|---|
Primer_r | CATAAATGTTCCTGGTGAGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |