KIAA1082

Product ID	ORK05559
Accession No	AB029005
Description	lysine (K)-specific demethylase 3B
Clone name	fg06837
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6691 bp) Predicted protein sequence (1787 aa)
HaloTag ORF Clone	FHC05559
Flexi ORF Clone	FXC05559
Source	Human fetal brain
Rouge ID	mKIAA1082 by Kazusa Mouse cDNA Project
Note	We replaced hj07386, former representative clones for KIAA1082 with fg06837. (2001/5/29)

Length: 6691 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1325 bp
Genome contig ID	gi51511721f_137616400
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ATTTCCATGTTCTTATTAAAAATCTAACAAATCTG
Flanking genome sequence (184217 - 184266)	----+--------+--------+--------+--------+----* TTTGGAGTGGACTAAATTATTCGTGTACCAACCCTTCTAAAATCAACATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	137716304	137800615	24	99.7	Perfect prediction

Length: 1787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_517956	99.8	jumonji domain ...	Pan troglodytes
Q7LBC6	100.0	JmjC domain-con...	Homo sapiens
XP_873047	96.1	similar to jumo...	Bos taurus
NP_001074725	93.6	jumonji domain ...	Mus musculus
EDL76245	93.5	rCG49501 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018285	1.2e-77	59.6	KIAA0742
AB037801	7.1e-63	40.1	KIAA1380

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	1619	1730	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	1524	1747	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	1524	1747	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Primer_f	TCCCATCTTAGTCTTACCTTG
Primer_r	GAAACATTAAGAGGAGTCCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCCATCTTAGTCTTACCTTG
Primer_r	GAAACATTAAGAGGAGTCCCC
PCR product length	158 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles