KIAA1884

Product ID	ORK04655
Accession No	AB067471
Description	CUB and Sushi multiple domains 2
Clone name	fh04567
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5463 bp) Predicted protein sequence (946 aa)
Source	Human fetal brain
Rouge ID	mKIAA1884 by Kazusa Mouse cDNA Project

Length: 5463 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2620 bp
Genome contig ID	gi89161185r_33652260
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTGAATTCAAATAAAATATAAATTTTTGCATTG
Flanking genome sequence (99936 - 99887)	----+--------+--------+--------+--------+----* GTTTTCTTACATTTTTATGGCCTCTTTCATGACTAGGGGCAAGTGTTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	33752196	33810839	20	99.5	Perfect prediction

Length: 946 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO34701	100.0	CUB and sushi m...	Homo sapiens
Q7Z408	99.9	CUB and sushi d...	Homo sapiens
EAX07450	99.8	CUB and Sushi m...	Homo sapiens
XP_851846	92.2	similar to CUB ...	Canis lupus fam...
BAD97692	86.5	CSMD2 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067481	1e-170	48.3	KIAA1894
AB067477	1.3e-09	23.0	KIAA1890
AB023144	1.7e-06	23.0	KIAA0927

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000436	3	47	PF00084	Sushi/SCR/CCP
	IPR000436	52	112	PF00084	Sushi/SCR/CCP
	IPR000436	117	170	PF00084	Sushi/SCR/CCP
	IPR000436	175	228	PF00084	Sushi/SCR/CCP
	IPR000436	233	286	PF00084	Sushi/SCR/CCP
	IPR000436	294	347	PF00084	Sushi/SCR/CCP
	IPR000436	352	406	PF00084	Sushi/SCR/CCP
	IPR000436	411	466	PF00084	Sushi/SCR/CCP
	IPR000436	471	524	PF00084	Sushi/SCR/CCP
	IPR000436	529	582	PF00084	Sushi/SCR/CCP
	IPR000436	590	644	PF00084	Sushi/SCR/CCP
	IPR000436	649	704	PF00084	Sushi/SCR/CCP
HMMSmart	IPR000436	2	47	SM00032	Sushi/SCR/CCP
	IPR000436	52	112	SM00032	Sushi/SCR/CCP
	IPR000436	117	170	SM00032	Sushi/SCR/CCP
	IPR000436	175	228	SM00032	Sushi/SCR/CCP
	IPR000436	233	286	SM00032	Sushi/SCR/CCP
	IPR000436	294	347	SM00032	Sushi/SCR/CCP
	IPR000436	352	406	SM00032	Sushi/SCR/CCP
	IPR000436	411	466	SM00032	Sushi/SCR/CCP
	IPR000436	471	524	SM00032	Sushi/SCR/CCP
	IPR000436	529	582	SM00032	Sushi/SCR/CCP
	IPR000436	590	644	SM00032	Sushi/SCR/CCP
	IPR000436	649	704	SM00032	Sushi/SCR/CCP
ProfileScan	IPR000436	1	49	PS50923	Sushi/SCR/CCP
	IPR000436	50	114	PS50923	Sushi/SCR/CCP
	IPR000436	115	172	PS50923	Sushi/SCR/CCP
	IPR000436	173	230	PS50923	Sushi/SCR/CCP
	IPR000436	231	288	PS50923	Sushi/SCR/CCP
	IPR000436	292	349	PS50923	Sushi/SCR/CCP
	IPR000436	350	408	PS50923	Sushi/SCR/CCP
	IPR000436	409	468	PS50923	Sushi/SCR/CCP
	IPR000436	469	526	PS50923	Sushi/SCR/CCP
	IPR000436	527	584	PS50923	Sushi/SCR/CCP
	IPR000436	588	646	PS50923	Sushi/SCR/CCP
	IPR000436	647	706	PS50923	Sushi/SCR/CCP
ScanRegExp	IPR003006	318	324	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	868	SSVAAAILVPFIALIIAGFVLYL	890	PRIMARY	23

Primer_f	CCTTGCGAGTGGGTTTGATTG
Primer_r	GCCAGCATGTCACACGTATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-