Order Kazusa clone(s) from : ![]() |
Product ID | ORK00935 |
---|---|
Accession No | AB058763 |
Description | MAP/microtubule affinity-regulating kinase 4, transcript variant 2 |
Clone name | fh18358 |
Vector information | |
cDNA sequence | DNA sequence (4917 bp) Predicted protein sequence (689 aa) |
Flexi ORF Clone | FXC00935 |
Source | Human fetal brain |
Rouge ID |
mKIAA1860
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2845 bp |
---|---|
Genome contig ID | gi42406306f_50346682 |
PolyA signal sequence (AGTAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (153701 - 153750) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 50446682 | 50500381 | 18 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 60 | 310 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 60 | 311 | PF00069 | Protein kinase |
IPR000449 | 331 | 370 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B | |
HMMSmart | IPR001245 | 60 | 310 | SM00219 | Tyrosine protein kinase |
IPR002290 | 60 | 311 | SM00220 | Serine/threonine protein kinase | |
IPR000449 | 332 | 369 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B | |
ProfileScan | IPR000719 | 60 | 311 | PS50011 | Protein kinase |
IPR000449 | 325 | 369 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B | |
ScanRegExp | IPR000719 | 66 | 89 | PS00107 | Protein kinase |
IPR008271 | 178 | 190 | PS00108 | Serine/threonine protein kinase |
![]() |
Primer_f | GCGCAGATAGATTTAAGAGAG |
---|---|
Primer_r | AGTTGAAGATCCCAGCTCCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |