KIAA0148

Product ID	ORK00029
Accession No	D63482
Description	G protein-coupled receptor kinase interacting ArfGAP 2, transcript variant 6
Clone name	fh23975
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5291 bp) Predicted protein sequence (704 aa)
HaloTag ORF Clone	FHC00029
Flexi ORF Clone	FXC00029
Source	Human fetal brain
Rouge ID	mKIAA0148 by Kazusa Mouse cDNA Project
Note	We replaced ha03431, former representative clones for KIAA0148 with fh23975. (2002/5/10)

Length: 5291 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3174 bp
Genome contig ID	gi89161190r_108751992
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCTGCTAGTTATGCAATAAACAGGCTCTACAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTTGTGGTAATGCTGTGCTCCCCATCAATTAGTTGATGTTTCCAGATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	108851992	108918483	18	99.8	Perfect prediction

Length: 704 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11141	100.0	ARF GTPase-acti...	synthetic construct
NP_055591	99.6	G protein-coupl...	Homo sapiens
XP_863901	96.0	similar to G pr...	Canis lupus fam...
XP_863985	95.7	similar to G pr...	Canis lupus fam...
NP_001070827	91.9	G protein-coupl...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029022	2.2e-08	32.7	KIAA1099
D79989	8.6e-08	33.3	KIAA0167
AB075855	2.1e-07	34.1	KIAA1975
AB051503	1e-06	38.7	KIAA1716
D26069	2.6e-06	40.9	KIAA0041

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	31	50	PR00405	Arf GTPase activating protein
	IPR001164	50	67	PR00405	Arf GTPase activating protein
	IPR001164	71	92	PR00405	Arf GTPase activating protein
HMMPfam	IPR001164	22	147	PF01412	Arf GTPase activating protein
	IPR002110	160	183	PF00023	Ankyrin
	IPR002110	189	221	PF00023	Ankyrin
	IPR002110	222	244	PF00023	Ankyrin
	IPR013724	291	321	PF08518	Spa2 homology (SHD) of GIT
	IPR013724	355	385	PF08518	Spa2 homology (SHD) of GIT
HMMSmart	IPR001164	22	147	SM00105	Arf GTPase activating protein
	IPR002110	155	184	SM00248	Ankyrin
	IPR002110	189	218	SM00248	Ankyrin
	IPR002110	222	251	SM00248	Ankyrin
	IPR013724	291	321	SM00555	Spa2 homology (SHD) of GIT
	IPR013724	355	385	SM00555	Spa2 homology (SHD) of GIT
ProfileScan	IPR001164	22	147	PS50115	Arf GTPase activating protein
	IPR002110	155	244	PS50297	Ankyrin
	IPR002110	189	221	PS50088	Ankyrin

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GCATCAGTAAATAGGGGAACG
Primer_r	CCACTCATAATAGACGCAGGG
PCR product length	203 (3.0k) bp
PCR conditions	95 °C15 sec64 °C180 sec30 cycles