Order Kazusa clone(s) from : ![]() |
Product ID | ORK00217 |
---|---|
Accession No | AB037763 |
Description | synaptotagmin IV |
Clone name | fj00418 |
Vector information | |
cDNA sequence | DNA sequence (3910 bp) Predicted protein sequence (426 aa) |
HaloTag ORF Clone |
FHC00217
![]() |
Flexi ORF Clone | FXC00217 |
Source | Human fetal brain |
Rouge ID |
mKIAA1342
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2446 bp |
---|---|
Genome contig ID | gi51511735r_39001857 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 18 | r | 39101857 | 39111430 | 4 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001565 | 158 | 173 | PR00399 | Synaptotagmin |
IPR001565 | 173 | 186 | PR00399 | Synaptotagmin | |
IPR000008 | 187 | 199 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 214 | 227 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR001565 | 230 | 245 | PR00399 | Synaptotagmin | |
IPR001565 | 250 | 260 | PR00399 | Synaptotagmin | |
HMMPfam | IPR000008 | 171 | 259 | PF00168 | C2 calcium-dependent membrane targeting |
IPR000008 | 305 | 393 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 170 | 274 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 304 | 418 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000008 | 171 | 259 | PS50004 | C2 calcium-dependent membrane targeting |
IPR000008 | 303 | 393 | PS50004 | C2 calcium-dependent membrane targeting |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 16 | PTVVGIFSAFGLVFTVSLFAWIC | 38 | PRIMARY | 23 |
---|
![]() |
Primer_f | TGAACTGTAGTAGGTGTGTAG |
---|---|
Primer_r | CTGCTACCACCATTAACTTCT |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |