Gene/Protein Characteristic Table for KIAA1473
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00846
Accession No AB040906
Description zinc finger protein 492
Clone name fj03262
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4133 bp)
Predicted protein sequence (574 aa)
Flexi ORF Clone FXC00846
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 4133 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2406 bp
Genome contig ID gi42406306f_22509079
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
TTCTGAGTCCTGAATAAATAAAAATAATTTCTTGT
Flanking genome sequence
(133235 - 133284)		 
----+----*----+----*----+----*----+----*----+----*
ATATTTTTCTTTGAATATGTGGCCTCTCTACTTGCAAACAGATACAGGCT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 22609079 22642312 4 99.1 Perfect prediction
Ensembl gnome browser 19 r 22363750 22396874 4 97.0 Perfect prediction
Features of the protein sequence
Description

Length: 574 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_001092096 0 97.5 zinc finger pro...
 Homo sapiens
Q9P255 0 100.0 Zinc finger pro...
 Homo sapiens
EAW84926 0 99.4 hCG1780278 [Hom...
 Homo sapiens
A6NK75 0 97.9 Zinc finger pro...
 Homo sapiens
AAI10577 0 97.7 ZNF98 protein [...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB075849 3.7e-120 74.0 KIAA1969
AB046831 9.8e-79 48.1 KIAA1611
AB046779 1.6e-77 50.5 KIAA1559
AB075862 7.3e-75 51.2 KIAA1982
AB058730 1.5e-71 53.9 KIAA1827
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 212 235 PD000003 Zinc finger
IPR007087 240 263 PD000003 Zinc finger
IPR007087 268 291 PD000003 Zinc finger
IPR007087 296 318 PD000003 Zinc finger
IPR007087 324 347 PD000003 Zinc finger
IPR007087 352 375 PD000003 Zinc finger
IPR007087 380 403 PD000003 Zinc finger
IPR007087 408 431 PD000003 Zinc finger
IPR007087 436 459 PD000003 Zinc finger
IPR007087 464 487 PD000003 Zinc finger
IPR007087 492 515 PD000003 Zinc finger
IPR007087 520 543 PD000003 Zinc finger
HMMPfam IPR001909 15 55 PF01352 KRAB box
IPR007087 184 206 PF00096 Zinc finger
IPR007087 212 234 PF00096 Zinc finger
IPR007087 240 262 PF00096 Zinc finger
IPR007087 268 290 PF00096 Zinc finger
IPR007087 296 318 PF00096 Zinc finger
IPR007087 324 346 PF00096 Zinc finger
IPR007087 352 374 PF00096 Zinc finger
IPR007087 380 402 PF00096 Zinc finger
IPR007087 408 430 PF00096 Zinc finger
IPR007087 436 458 PF00096 Zinc finger
IPR007087 464 486 PF00096 Zinc finger
IPR007087 492 514 PF00096 Zinc finger
IPR007087 520 542 PF00096 Zinc finger
HMMSmart IPR001909 15 75 SM00349 KRAB box
IPR015880 184 206 SM00355 Zinc finger
IPR015880 212 234 SM00355 Zinc finger
IPR015880 240 262 SM00355 Zinc finger
IPR015880 268 290 SM00355 Zinc finger
IPR015880 296 318 SM00355 Zinc finger
IPR015880 324 346 SM00355 Zinc finger
IPR015880 352 374 SM00355 Zinc finger
IPR015880 380 402 SM00355 Zinc finger
IPR015880 408 430 SM00355 Zinc finger
IPR015880 436 458 SM00355 Zinc finger
IPR015880 464 486 SM00355 Zinc finger
IPR015880 492 514 SM00355 Zinc finger
IPR015880 520 542 SM00355 Zinc finger
ProfileScan IPR001909 15 86 PS50805 KRAB box
IPR007087 184 211 PS50157 Zinc finger
IPR007087 212 239 PS50157 Zinc finger
IPR007087 240 267 PS50157 Zinc finger
IPR007087 268 295 PS50157 Zinc finger
IPR007087 296 323 PS50157 Zinc finger
IPR007087 324 351 PS50157 Zinc finger
IPR007087 352 379 PS50157 Zinc finger
IPR007087 380 407 PS50157 Zinc finger
IPR007087 408 435 PS50157 Zinc finger
IPR007087 436 463 PS50157 Zinc finger
IPR007087 464 491 PS50157 Zinc finger
IPR007087 492 519 PS50157 Zinc finger
IPR007087 520 547 PS50157 Zinc finger
ScanRegExp IPR007087 186 206 PS00028 Zinc finger
IPR007087 214 234 PS00028 Zinc finger
IPR007087 242 262 PS00028 Zinc finger
IPR007087 270 290 PS00028 Zinc finger
IPR007087 298 318 PS00028 Zinc finger
IPR007087 326 346 PS00028 Zinc finger
IPR007087 354 374 PS00028 Zinc finger
IPR007087 382 402 PS00028 Zinc finger
IPR007087 410 430 PS00028 Zinc finger
IPR007087 438 458 PS00028 Zinc finger
IPR007087 466 486 PS00028 Zinc finger
IPR007087 522 542 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GGAAGCCTAGAAACGGGAGTG
Primer_r GCAATACCCACGAAGACCAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name CCR
Primer_f GCATGAGGTAGGTGTTCTGAG
Primer_r CCTTTTACCTACACCCTTGAG
PCR product length 266 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp