KIAA1374

Product ID	ORK05494
Accession No	AB037795
Description	intraflagellar transport 80
Clone name	fj04345
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4044 bp) Predicted protein sequence (764 aa)
Source	Human fetal brain
Rouge ID	mKIAA1374 by Kazusa Mouse cDNA Project

Length: 4044 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1533 bp
Genome contig ID	gi89161205r_161357545
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CACAATAAATGCAAAAAATAAAAAGTCTGTGTTCT
Flanking genome sequence (99929 - 99880)	----+--------+--------+--------+--------+----* AAACAATTCTCTCATATCCTAGAATTCAATCCAATTCTAACACTAACTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	161457474	161584138	19	100.0	Perfect prediction

Length: 764 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2H3	100.0	Intraflagellar ...	Homo sapiens
AAI01495	100.0	Intraflagellar ...	Homo sapiens
XP_001093524	97.5	similar to WD r...	Macaca mulatta
XP_545256	96.6	similar to WD r...	Canis lupus fam...
AAI42311	95.9	IFT80 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075822	8.8e-06	25.1	KIAA1942
AB046858	0.00053	20.6	KIAA1638
AB033087	0.00084	26.6	KIAA1261

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	15	29	PR00320	WD40 repeat
	IPR001680	108	122	PR00320	WD40 repeat
	IPR001680	190	204	PR00320	WD40 repeat
HMMPfam	IPR001680	83	121	PF00400	WD40 repeat
	IPR001680	165	203	PF00400	WD40 repeat
	IPR001680	206	243	PF00400	WD40 repeat
HMMSmart	IPR001680	82	121	SM00320	WD40 repeat
	IPR001680	123	163	SM00320	WD40 repeat
	IPR001680	164	203	SM00320	WD40 repeat
	IPR001680	205	243	SM00320	WD40 repeat
	IPR001680	245	284	SM00320	WD40 repeat
	IPR001680	483	520	SM00320	WD40 repeat
ProfileScan	IPR001680	89	121	PS50082	WD40 repeat
	IPR001680	89	212	PS50294	WD40 repeat
	IPR001680	171	203	PS50082	WD40 repeat

Primer_f	TCATCAGAACTAGGAAAGCAC
Primer_r	TCTTCAGCAGTAGTCCAGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGGGCGCTTTATTTCATCTCC
Primer_r	TTCCATCACCTAACGGCTTTC
PCR product length	164(800) bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles